Incidental Mutation 'R0612:Ccdc174'
ID 54808
Institutional Source Beutler Lab
Gene Symbol Ccdc174
Ensembl Gene ENSMUSG00000034083
Gene Name coiled-coil domain containing 174
Synonyms C130022K22Rik
MMRRC Submission 038801-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0612 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 91855034-91876824 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 91867873 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037783] [ENSMUST00000136090]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037783
SMART Domains Protein: ENSMUSP00000049280
Gene: ENSMUSG00000034083

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
coiled coil region 64 98 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
Pfam:DUF4078 215 303 4.4e-32 PFAM
low complexity region 323 340 N/A INTRINSIC
low complexity region 423 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151378
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.5%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it interacts with eukaryotic translation initiation factor 4A, isoform 3. The encoded protein appears to be a part of the exon junction complex, which is involved in RNA processing, translation, and nonsense-mediated mRNA decay. A mutation in this gene has been associated with infantile hypotonia with psychomotor retardation. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 119,936,478 (GRCm39) L181P probably damaging Het
Aldh3a1 A T 11: 61,105,445 (GRCm39) I184F probably damaging Het
Arl6ip4 A G 5: 124,254,596 (GRCm39) S30G probably benign Het
Atp9b T C 18: 80,797,171 (GRCm39) E891G possibly damaging Het
Brsk1 T C 7: 4,710,425 (GRCm39) L478P possibly damaging Het
Btaf1 G A 19: 36,946,537 (GRCm39) V448I probably damaging Het
Cab39 T C 1: 85,746,236 (GRCm39) probably null Het
Cacna2d4 G T 6: 119,258,679 (GRCm39) probably benign Het
Capzb C T 4: 139,018,340 (GRCm39) S253L probably benign Het
Ccdc180 C T 4: 45,927,969 (GRCm39) A1168V probably damaging Het
Cdh19 T C 1: 110,820,900 (GRCm39) probably benign Het
Cdh8 T C 8: 100,127,546 (GRCm39) T22A probably benign Het
Cdk10 T C 8: 123,957,419 (GRCm39) V181A probably benign Het
Ceacam15 A C 7: 16,407,445 (GRCm39) L24* probably null Het
Cftr A C 6: 18,198,125 (GRCm39) T20P probably benign Het
Cip2a C T 16: 48,819,402 (GRCm39) A112V probably benign Het
Clstn3 T C 6: 124,426,459 (GRCm39) T576A probably damaging Het
Col1a2 G A 6: 4,516,003 (GRCm39) V165I unknown Het
Copg2 A T 6: 30,838,404 (GRCm39) probably null Het
Cps1 A G 1: 67,178,929 (GRCm39) H47R probably benign Het
Cytip T C 2: 58,024,202 (GRCm39) D206G possibly damaging Het
Dcaf8l G A X: 88,448,972 (GRCm39) R386* probably null Het
Dnmt1 C T 9: 20,829,489 (GRCm39) E824K probably damaging Het
Dock7 A C 4: 98,877,470 (GRCm39) V442G probably benign Het
Dsc1 T G 18: 20,247,573 (GRCm39) K14T probably damaging Het
Dync1h1 C T 12: 110,582,930 (GRCm39) P371L probably damaging Het
Enah A G 1: 181,734,013 (GRCm39) probably benign Het
Entrep2 C T 7: 64,411,549 (GRCm39) V395M probably benign Het
Fastkd1 T C 2: 69,542,727 (GRCm39) T27A probably benign Het
Fcho1 A G 8: 72,168,168 (GRCm39) L248P probably damaging Het
Fezf1 A T 6: 23,247,028 (GRCm39) V268D probably damaging Het
Fgd2 T A 17: 29,597,321 (GRCm39) V547E probably benign Het
Flnb T A 14: 7,887,682 (GRCm38) probably benign Het
Gabrg3 A G 7: 56,379,454 (GRCm39) M316T probably damaging Het
Gigyf2 T C 1: 87,376,802 (GRCm39) F1265L probably damaging Het
Git2 A G 5: 114,890,342 (GRCm39) S271P probably damaging Het
Gorab T C 1: 163,224,738 (GRCm39) D21G possibly damaging Het
Gpr179 T A 11: 97,229,264 (GRCm39) T964S possibly damaging Het
Hdac5 A G 11: 102,087,078 (GRCm39) V1042A possibly damaging Het
Hoxa2 T A 6: 52,140,540 (GRCm39) T149S probably damaging Het
Igsf8 G T 1: 172,146,974 (GRCm39) *108L probably null Het
Il1rap C T 16: 26,519,855 (GRCm39) T307M possibly damaging Het
Itih2 T C 2: 10,122,205 (GRCm39) D232G probably benign Het
Jak3 A G 8: 72,136,021 (GRCm39) Y607C probably damaging Het
Kcnh1 C T 1: 191,959,361 (GRCm39) P305L probably damaging Het
Lrrc7 T A 3: 157,869,990 (GRCm39) I644F probably damaging Het
Lrrn2 T C 1: 132,865,466 (GRCm39) L177P probably damaging Het
Lypd8l A G 11: 58,502,799 (GRCm39) probably null Het
Map4k3 C A 17: 80,909,622 (GRCm39) K712N probably damaging Het
Med11 A G 11: 70,342,910 (GRCm39) T36A probably benign Het
Mmp14 A G 14: 54,677,891 (GRCm39) D504G probably damaging Het
Mob1a A G 6: 83,311,140 (GRCm39) T120A probably benign Het
Mr1 T A 1: 155,013,436 (GRCm39) D47V probably damaging Het
Nacad G T 11: 6,551,382 (GRCm39) A603E possibly damaging Het
Nwd1 T A 8: 73,394,308 (GRCm39) W524R probably damaging Het
Or11g26 A T 14: 50,752,939 (GRCm39) T93S probably benign Het
Or13a19 T A 7: 139,903,101 (GRCm39) M163K possibly damaging Het
Or4e1 T C 14: 52,701,008 (GRCm39) T153A probably benign Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pde6c T A 19: 38,121,694 (GRCm39) C101S probably benign Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pdlim4 G A 11: 53,959,713 (GRCm39) R16C probably damaging Het
Pfkp A G 13: 6,655,670 (GRCm39) probably null Het
Plcg2 T A 8: 118,300,104 (GRCm39) S225T probably benign Het
Pramel1 T C 4: 143,124,101 (GRCm39) S259P probably damaging Het
Pramel27 G T 4: 143,578,658 (GRCm39) probably benign Het
Rc3h2 T C 2: 37,301,227 (GRCm39) N92D possibly damaging Het
Ric8b C A 10: 84,837,745 (GRCm39) N517K probably damaging Het
Rnf34 G A 5: 123,002,237 (GRCm39) R65H probably damaging Het
Rraga C T 4: 86,494,564 (GRCm39) R137C probably damaging Het
Scube2 C T 7: 109,403,971 (GRCm39) probably benign Het
Slc28a2b T C 2: 122,352,179 (GRCm39) M339T probably damaging Het
Spata31d1d T C 13: 59,875,787 (GRCm39) I583V probably benign Het
Suox T C 10: 128,506,525 (GRCm39) E501G probably benign Het
Susd1 A G 4: 59,390,561 (GRCm39) probably benign Het
Tac1 T C 6: 7,555,653 (GRCm39) S14P probably damaging Het
Tbc1d8 T C 1: 39,411,596 (GRCm39) E1080G possibly damaging Het
Tll1 A C 8: 64,524,344 (GRCm39) S447R possibly damaging Het
Tmem132e G A 11: 82,334,198 (GRCm39) V662M probably damaging Het
Upf2 G T 2: 6,038,909 (GRCm39) probably benign Het
Uspl1 A G 5: 149,151,767 (GRCm39) E989G probably damaging Het
Vmn1r58 T C 7: 5,413,618 (GRCm39) H204R probably damaging Het
Vmn2r25 A T 6: 123,816,481 (GRCm39) C367S probably damaging Het
Vps13b A T 15: 35,623,803 (GRCm39) Q1240L probably benign Het
Xrcc1 C T 7: 24,269,744 (GRCm39) probably benign Het
Yeats2 T G 16: 20,005,175 (GRCm39) V385G probably benign Het
Other mutations in Ccdc174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Ccdc174 APN 6 91,857,343 (GRCm39) critical splice donor site probably null
IGL02391:Ccdc174 APN 6 91,875,263 (GRCm39) missense possibly damaging 0.72
IGL02619:Ccdc174 APN 6 91,876,538 (GRCm39) missense possibly damaging 0.70
IGL02698:Ccdc174 APN 6 91,867,834 (GRCm39) missense probably benign
R0482:Ccdc174 UTSW 6 91,872,247 (GRCm39) missense probably benign 0.08
R0801:Ccdc174 UTSW 6 91,872,313 (GRCm39) missense possibly damaging 0.72
R1124:Ccdc174 UTSW 6 91,876,561 (GRCm39) missense probably benign 0.33
R1237:Ccdc174 UTSW 6 91,867,768 (GRCm39) splice site probably benign
R1388:Ccdc174 UTSW 6 91,858,225 (GRCm39) splice site probably null
R2176:Ccdc174 UTSW 6 91,865,070 (GRCm39) missense probably benign 0.01
R3914:Ccdc174 UTSW 6 91,876,338 (GRCm39) missense possibly damaging 0.70
R4342:Ccdc174 UTSW 6 91,862,337 (GRCm39) nonsense probably null
R4775:Ccdc174 UTSW 6 91,867,875 (GRCm39) splice site probably null
R4880:Ccdc174 UTSW 6 91,876,572 (GRCm39) unclassified probably benign
R5579:Ccdc174 UTSW 6 91,858,331 (GRCm39) splice site probably null
R5787:Ccdc174 UTSW 6 91,858,291 (GRCm39) nonsense probably null
R5869:Ccdc174 UTSW 6 91,862,399 (GRCm39) utr 3 prime probably benign
R6277:Ccdc174 UTSW 6 91,857,272 (GRCm39) missense probably damaging 1.00
R8492:Ccdc174 UTSW 6 91,865,138 (GRCm39) missense probably benign 0.03
RF008:Ccdc174 UTSW 6 91,876,347 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGGGCACAGCAAGCTTAGTGAGTC -3'
(R):5'- CAGGTTGTTCCCTGAGCACAGAAG -3'

Sequencing Primer
(F):5'- GCAAGCTTAGTGAGTCTCAGC -3'
(R):5'- GTTCCCTGAGCACAGAAGATTATG -3'
Posted On 2013-07-11