Incidental Mutation 'R0612:Cacna2d4'
ID54809
Institutional Source Beutler Lab
Gene Symbol Cacna2d4
Ensembl Gene ENSMUSG00000041460
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms5730412N02Rik
MMRRC Submission 038801-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0612 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119236526-119352407 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 119281718 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037434] [ENSMUST00000186622]
Predicted Effect probably benign
Transcript: ENSMUST00000037434
SMART Domains Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 7.3e-40 PFAM
VWA 296 481 4.37e-14 SMART
Pfam:Cache_1 494 586 1.1e-24 PFAM
low complexity region 837 849 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1000 1011 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186622
SMART Domains Protein: ENSMUSP00000140197
Gene: ENSMUSG00000041460

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 6.4e-44 PFAM
VWA 296 481 2.7e-16 SMART
Pfam:Cache_1 494 559 1.1e-7 PFAM
low complexity region 812 824 N/A INTRINSIC
low complexity region 950 959 N/A INTRINSIC
low complexity region 975 986 N/A INTRINSIC
low complexity region 1095 1118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190015
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.5%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit severe loss of retinal signaling associated with abnormal photoreceptor ribbon synapses and cone-rod dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,611,973 probably null Het
Abca15 T C 7: 120,337,255 L181P probably damaging Het
Aldh3a1 A T 11: 61,214,619 I184F probably damaging Het
Arl6ip4 A G 5: 124,116,533 S30G probably benign Het
Atp9b T C 18: 80,753,956 E891G possibly damaging Het
Brsk1 T C 7: 4,707,426 L478P possibly damaging Het
Btaf1 G A 19: 36,969,137 V448I probably damaging Het
C330027C09Rik C T 16: 48,999,039 A112V probably benign Het
Cab39 T C 1: 85,818,515 probably null Het
Capzb C T 4: 139,291,029 S253L probably benign Het
Ccdc174 A G 6: 91,890,892 probably benign Het
Ccdc180 C T 4: 45,927,969 A1168V probably damaging Het
Cdh19 T C 1: 110,893,170 probably benign Het
Cdh8 T C 8: 99,400,914 T22A probably benign Het
Cdk10 T C 8: 123,230,680 V181A probably benign Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cftr A C 6: 18,198,126 T20P probably benign Het
Clstn3 T C 6: 124,449,500 T576A probably damaging Het
Col1a2 G A 6: 4,516,003 V165I unknown Het
Copg2 A T 6: 30,861,469 probably null Het
Cps1 A G 1: 67,139,770 H47R probably benign Het
Cytip T C 2: 58,134,190 D206G possibly damaging Het
Dnmt1 C T 9: 20,918,193 E824K probably damaging Het
Dock7 A C 4: 98,989,233 V442G probably benign Het
Dsc1 T G 18: 20,114,516 K14T probably damaging Het
Dync1h1 C T 12: 110,616,496 P371L probably damaging Het
Enah A G 1: 181,906,448 probably benign Het
Fam189a1 C T 7: 64,761,801 V395M probably benign Het
Fastkd1 T C 2: 69,712,383 T27A probably benign Het
Fcho1 A G 8: 71,715,524 L248P probably damaging Het
Fezf1 A T 6: 23,247,029 V268D probably damaging Het
Fgd2 T A 17: 29,378,347 V547E probably benign Het
Flnb T A 14: 7,887,682 probably benign Het
Gabrg3 A G 7: 56,729,706 M316T probably damaging Het
Gigyf2 T C 1: 87,449,080 F1265L probably damaging Het
Git2 A G 5: 114,752,281 S271P probably damaging Het
Gm13103 G T 4: 143,852,088 probably benign Het
Gm14085 T C 2: 122,521,698 M339T probably damaging Het
Gorab T C 1: 163,397,169 D21G possibly damaging Het
Gpr179 T A 11: 97,338,438 T964S possibly damaging Het
Hdac5 A G 11: 102,196,252 V1042A possibly damaging Het
Hoxa2 T A 6: 52,163,560 T149S probably damaging Het
Igsf8 G T 1: 172,319,407 *108L probably null Het
Il1rap C T 16: 26,701,105 T307M possibly damaging Het
Itih2 T C 2: 10,117,394 D232G probably benign Het
Jak3 A G 8: 71,683,377 Y607C probably damaging Het
Kcnh1 C T 1: 192,277,053 P305L probably damaging Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Lrrn2 T C 1: 132,937,728 L177P probably damaging Het
Map4k3 C A 17: 80,602,193 K712N probably damaging Het
Med11 A G 11: 70,452,084 T36A probably benign Het
Mmp14 A G 14: 54,440,434 D504G probably damaging Het
Mob1a A G 6: 83,334,158 T120A probably benign Het
Mr1 T A 1: 155,137,690 D47V probably damaging Het
Nacad G T 11: 6,601,382 A603E possibly damaging Het
Nwd1 T A 8: 72,667,680 W524R probably damaging Het
Olfr1508 T C 14: 52,463,551 T153A probably benign Het
Olfr525 T A 7: 140,323,188 M163K possibly damaging Het
Olfr742 A T 14: 50,515,482 T93S probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pde6c T A 19: 38,133,246 C101S probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdlim4 G A 11: 54,068,887 R16C probably damaging Het
Pet2 G A X: 89,405,366 R386* probably null Het
Pfkp A G 13: 6,605,634 probably null Het
Plcg2 T A 8: 117,573,365 S225T probably benign Het
Pramel1 T C 4: 143,397,531 S259P probably damaging Het
Rc3h2 T C 2: 37,411,215 N92D possibly damaging Het
Ric8b C A 10: 85,001,881 N517K probably damaging Het
Rnf34 G A 5: 122,864,174 R65H probably damaging Het
Rraga C T 4: 86,576,327 R137C probably damaging Het
Scube2 C T 7: 109,804,764 probably benign Het
Spata31d1d T C 13: 59,727,973 I583V probably benign Het
Suox T C 10: 128,670,656 E501G probably benign Het
Susd1 A G 4: 59,390,561 probably benign Het
Tac1 T C 6: 7,555,653 S14P probably damaging Het
Tbc1d8 T C 1: 39,372,515 E1080G possibly damaging Het
Tll1 A C 8: 64,071,310 S447R possibly damaging Het
Tmem132e G A 11: 82,443,372 V662M probably damaging Het
Upf2 G T 2: 6,034,098 probably benign Het
Uspl1 A G 5: 149,214,957 E989G probably damaging Het
Vmn1r58 T C 7: 5,410,619 H204R probably damaging Het
Vmn2r25 A T 6: 123,839,522 C367S probably damaging Het
Vps13b A T 15: 35,623,657 Q1240L probably benign Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Yeats2 T G 16: 20,186,425 V385G probably benign Het
Other mutations in Cacna2d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Cacna2d4 APN 6 119337933 splice site probably benign
IGL00469:Cacna2d4 APN 6 119268278 missense probably damaging 1.00
IGL00518:Cacna2d4 APN 6 119343575 missense probably damaging 1.00
IGL00946:Cacna2d4 APN 6 119271915 missense possibly damaging 0.82
IGL01447:Cacna2d4 APN 6 119242904 missense probably damaging 1.00
IGL01514:Cacna2d4 APN 6 119282173 splice site probably benign
IGL01576:Cacna2d4 APN 6 119281641 nonsense probably null
IGL01934:Cacna2d4 APN 6 119308768 missense probably damaging 1.00
IGL02231:Cacna2d4 APN 6 119277908 splice site probably benign
IGL02516:Cacna2d4 APN 6 119271870 splice site probably benign
IGL02688:Cacna2d4 APN 6 119270749 splice site probably null
IGL03110:Cacna2d4 APN 6 119236737 missense probably benign 0.05
IGL03365:Cacna2d4 APN 6 119271264 missense probably benign 0.15
saccharine UTSW 6 119345106 splice site probably benign
Steveo UTSW 6 119347252 critical splice donor site probably null
Sussmann UTSW 6 119274318 missense probably damaging 1.00
R0139:Cacna2d4 UTSW 6 119278269 intron probably benign
R0157:Cacna2d4 UTSW 6 119312424 missense probably benign 0.00
R0158:Cacna2d4 UTSW 6 119236748 missense possibly damaging 0.68
R0245:Cacna2d4 UTSW 6 119308721 missense probably damaging 1.00
R0659:Cacna2d4 UTSW 6 119345106 splice site probably benign
R0722:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0743:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0833:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0835:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0836:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0884:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1052:Cacna2d4 UTSW 6 119300333 missense probably damaging 1.00
R1168:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1170:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1451:Cacna2d4 UTSW 6 119236824 missense probably benign 0.01
R1564:Cacna2d4 UTSW 6 119241195 missense possibly damaging 0.67
R1809:Cacna2d4 UTSW 6 119270824 missense probably damaging 0.99
R1936:Cacna2d4 UTSW 6 119270761 missense possibly damaging 0.82
R2078:Cacna2d4 UTSW 6 119338116 missense probably benign 0.02
R2198:Cacna2d4 UTSW 6 119347259 splice site probably benign
R2280:Cacna2d4 UTSW 6 119350041 missense possibly damaging 0.85
R3757:Cacna2d4 UTSW 6 119241163 missense probably damaging 0.98
R3975:Cacna2d4 UTSW 6 119278173 splice site probably null
R3976:Cacna2d4 UTSW 6 119278173 splice site probably null
R4238:Cacna2d4 UTSW 6 119240708 missense probably null 1.00
R4591:Cacna2d4 UTSW 6 119298464 missense probably benign 0.02
R4856:Cacna2d4 UTSW 6 119278256 missense possibly damaging 0.90
R4899:Cacna2d4 UTSW 6 119268196 nonsense probably null
R5319:Cacna2d4 UTSW 6 119347252 critical splice donor site probably null
R5351:Cacna2d4 UTSW 6 119268201 missense probably damaging 1.00
R5366:Cacna2d4 UTSW 6 119274318 missense probably damaging 1.00
R5393:Cacna2d4 UTSW 6 119239054 missense probably benign 0.20
R5395:Cacna2d4 UTSW 6 119271418 missense possibly damaging 0.71
R5408:Cacna2d4 UTSW 6 119348791 missense probably damaging 1.00
R5603:Cacna2d4 UTSW 6 119244285 missense probably damaging 1.00
R5661:Cacna2d4 UTSW 6 119343531 missense probably benign
R5898:Cacna2d4 UTSW 6 119274231 missense probably damaging 1.00
R5928:Cacna2d4 UTSW 6 119281698 missense probably benign 0.06
R6186:Cacna2d4 UTSW 6 119281689 missense possibly damaging 0.94
R6218:Cacna2d4 UTSW 6 119239060 missense probably damaging 0.99
R6257:Cacna2d4 UTSW 6 119281619 critical splice acceptor site probably null
R6409:Cacna2d4 UTSW 6 119282228 missense probably damaging 0.99
R6931:Cacna2d4 UTSW 6 119282234 missense possibly damaging 0.49
R7221:Cacna2d4 UTSW 6 119236663 missense probably benign 0.02
R7363:Cacna2d4 UTSW 6 119343978 missense probably damaging 1.00
R7371:Cacna2d4 UTSW 6 119308709 missense probably benign 0.07
R7382:Cacna2d4 UTSW 6 119239087 missense probably damaging 1.00
R7431:Cacna2d4 UTSW 6 119244276 missense probably damaging 0.98
R7517:Cacna2d4 UTSW 6 119271921 missense probably benign 0.01
R7527:Cacna2d4 UTSW 6 119271247 missense probably benign 0.00
R7529:Cacna2d4 UTSW 6 119270766 missense probably benign 0.01
R7710:Cacna2d4 UTSW 6 119274239 missense probably benign 0.05
R7880:Cacna2d4 UTSW 6 119349155 missense probably damaging 0.99
R8007:Cacna2d4 UTSW 6 119312444 missense probably benign
R8084:Cacna2d4 UTSW 6 119300352 missense probably damaging 1.00
R8159:Cacna2d4 UTSW 6 119297527 missense probably benign 0.01
R8391:Cacna2d4 UTSW 6 119348745 missense probably benign 0.04
R8700:Cacna2d4 UTSW 6 119281693 missense not run
RF023:Cacna2d4 UTSW 6 119268230 missense probably benign 0.19
Z1176:Cacna2d4 UTSW 6 119312450 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AGGCCATCTGTGGCACACATTG -3'
(R):5'- TCTCAGTAACCTGTGACACCAGGG -3'

Sequencing Primer
(F):5'- agtgtaagtttggtctggctc -3'
(R):5'- CCACAGTTGCTGAAAGGATC -3'
Posted On2013-07-11