Incidental Mutation 'R0612:Clstn3'
ID54810
Institutional Source Beutler Lab
Gene Symbol Clstn3
Ensembl Gene ENSMUSG00000008153
Gene Namecalsyntenin 3
Synonymsalcadein-beta, Cst-3, CSTN3
MMRRC Submission 038801-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0612 (G1)
Quality Score196
Status Validated
Chromosome6
Chromosomal Location124430759-124464794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124449500 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 576 (T576A)
Ref Sequence ENSEMBL: ENSMUSP00000108142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523]
Predicted Effect probably damaging
Transcript: ENSMUST00000008297
AA Change: T613A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: T613A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 50 143 2.72e-12 SMART
CA 166 244 4.04e-2 SMART
SCOP:d1a8d_1 333 549 7e-23 SMART
transmembrane domain 846 868 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112523
AA Change: T576A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: T576A

DomainStartEndE-ValueType
CA 13 106 2.72e-12 SMART
CA 129 207 4.04e-2 SMART
Pfam:Laminin_G_3 304 505 4.1e-8 PFAM
transmembrane domain 809 831 N/A INTRINSIC
low complexity region 891 908 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147947
Meta Mutation Damage Score 0.5426 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.5%
Validation Efficiency 98% (92/94)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,611,973 probably null Het
Abca15 T C 7: 120,337,255 L181P probably damaging Het
Aldh3a1 A T 11: 61,214,619 I184F probably damaging Het
Arl6ip4 A G 5: 124,116,533 S30G probably benign Het
Atp9b T C 18: 80,753,956 E891G possibly damaging Het
Brsk1 T C 7: 4,707,426 L478P possibly damaging Het
Btaf1 G A 19: 36,969,137 V448I probably damaging Het
C330027C09Rik C T 16: 48,999,039 A112V probably benign Het
Cab39 T C 1: 85,818,515 probably null Het
Cacna2d4 G T 6: 119,281,718 probably benign Het
Capzb C T 4: 139,291,029 S253L probably benign Het
Ccdc174 A G 6: 91,890,892 probably benign Het
Ccdc180 C T 4: 45,927,969 A1168V probably damaging Het
Cdh19 T C 1: 110,893,170 probably benign Het
Cdh8 T C 8: 99,400,914 T22A probably benign Het
Cdk10 T C 8: 123,230,680 V181A probably benign Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cftr A C 6: 18,198,126 T20P probably benign Het
Col1a2 G A 6: 4,516,003 V165I unknown Het
Copg2 A T 6: 30,861,469 probably null Het
Cps1 A G 1: 67,139,770 H47R probably benign Het
Cytip T C 2: 58,134,190 D206G possibly damaging Het
Dnmt1 C T 9: 20,918,193 E824K probably damaging Het
Dock7 A C 4: 98,989,233 V442G probably benign Het
Dsc1 T G 18: 20,114,516 K14T probably damaging Het
Dync1h1 C T 12: 110,616,496 P371L probably damaging Het
Enah A G 1: 181,906,448 probably benign Het
Fam189a1 C T 7: 64,761,801 V395M probably benign Het
Fastkd1 T C 2: 69,712,383 T27A probably benign Het
Fcho1 A G 8: 71,715,524 L248P probably damaging Het
Fezf1 A T 6: 23,247,029 V268D probably damaging Het
Fgd2 T A 17: 29,378,347 V547E probably benign Het
Flnb T A 14: 7,887,682 probably benign Het
Gabrg3 A G 7: 56,729,706 M316T probably damaging Het
Gigyf2 T C 1: 87,449,080 F1265L probably damaging Het
Git2 A G 5: 114,752,281 S271P probably damaging Het
Gm13103 G T 4: 143,852,088 probably benign Het
Gm14085 T C 2: 122,521,698 M339T probably damaging Het
Gorab T C 1: 163,397,169 D21G possibly damaging Het
Gpr179 T A 11: 97,338,438 T964S possibly damaging Het
Hdac5 A G 11: 102,196,252 V1042A possibly damaging Het
Hoxa2 T A 6: 52,163,560 T149S probably damaging Het
Igsf8 G T 1: 172,319,407 *108L probably null Het
Il1rap C T 16: 26,701,105 T307M possibly damaging Het
Itih2 T C 2: 10,117,394 D232G probably benign Het
Jak3 A G 8: 71,683,377 Y607C probably damaging Het
Kcnh1 C T 1: 192,277,053 P305L probably damaging Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Lrrn2 T C 1: 132,937,728 L177P probably damaging Het
Map4k3 C A 17: 80,602,193 K712N probably damaging Het
Med11 A G 11: 70,452,084 T36A probably benign Het
Mmp14 A G 14: 54,440,434 D504G probably damaging Het
Mob1a A G 6: 83,334,158 T120A probably benign Het
Mr1 T A 1: 155,137,690 D47V probably damaging Het
Nacad G T 11: 6,601,382 A603E possibly damaging Het
Nwd1 T A 8: 72,667,680 W524R probably damaging Het
Olfr1508 T C 14: 52,463,551 T153A probably benign Het
Olfr525 T A 7: 140,323,188 M163K possibly damaging Het
Olfr742 A T 14: 50,515,482 T93S probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pde6c T A 19: 38,133,246 C101S probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdlim4 G A 11: 54,068,887 R16C probably damaging Het
Pet2 G A X: 89,405,366 R386* probably null Het
Pfkp A G 13: 6,605,634 probably null Het
Plcg2 T A 8: 117,573,365 S225T probably benign Het
Pramel1 T C 4: 143,397,531 S259P probably damaging Het
Rc3h2 T C 2: 37,411,215 N92D possibly damaging Het
Ric8b C A 10: 85,001,881 N517K probably damaging Het
Rnf34 G A 5: 122,864,174 R65H probably damaging Het
Rraga C T 4: 86,576,327 R137C probably damaging Het
Scube2 C T 7: 109,804,764 probably benign Het
Spata31d1d T C 13: 59,727,973 I583V probably benign Het
Suox T C 10: 128,670,656 E501G probably benign Het
Susd1 A G 4: 59,390,561 probably benign Het
Tac1 T C 6: 7,555,653 S14P probably damaging Het
Tbc1d8 T C 1: 39,372,515 E1080G possibly damaging Het
Tll1 A C 8: 64,071,310 S447R possibly damaging Het
Tmem132e G A 11: 82,443,372 V662M probably damaging Het
Upf2 G T 2: 6,034,098 probably benign Het
Uspl1 A G 5: 149,214,957 E989G probably damaging Het
Vmn1r58 T C 7: 5,410,619 H204R probably damaging Het
Vmn2r25 A T 6: 123,839,522 C367S probably damaging Het
Vps13b A T 15: 35,623,657 Q1240L probably benign Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Yeats2 T G 16: 20,186,425 V385G probably benign Het
Other mutations in Clstn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Clstn3 APN 6 124462139 missense probably damaging 1.00
IGL01415:Clstn3 APN 6 124438822 nonsense probably null
IGL01521:Clstn3 APN 6 124458031 nonsense probably null
IGL01537:Clstn3 APN 6 124431600 missense possibly damaging 0.91
IGL01729:Clstn3 APN 6 124449794 missense probably benign 0.06
IGL01879:Clstn3 APN 6 124438810 missense probably damaging 1.00
IGL01998:Clstn3 APN 6 124458663 missense probably damaging 1.00
IGL03130:Clstn3 APN 6 124459263 missense probably damaging 0.98
IGL03405:Clstn3 APN 6 124438368 missense possibly damaging 0.95
PIT4403001:Clstn3 UTSW 6 124458023 missense probably damaging 1.00
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0208:Clstn3 UTSW 6 124432169 splice site probably benign
R0276:Clstn3 UTSW 6 124431740 splice site probably benign
R0440:Clstn3 UTSW 6 124451413 missense probably damaging 1.00
R1200:Clstn3 UTSW 6 124459170 missense probably damaging 1.00
R1224:Clstn3 UTSW 6 124457919 missense probably benign
R1378:Clstn3 UTSW 6 124438419 missense probably damaging 1.00
R1491:Clstn3 UTSW 6 124437490 missense possibly damaging 0.51
R1495:Clstn3 UTSW 6 124449917 missense probably benign 0.00
R1511:Clstn3 UTSW 6 124462169 missense probably damaging 1.00
R1655:Clstn3 UTSW 6 124437427 missense probably damaging 1.00
R1731:Clstn3 UTSW 6 124431632 missense probably benign 0.04
R1734:Clstn3 UTSW 6 124436814 splice site probably benign
R1751:Clstn3 UTSW 6 124431999 missense probably damaging 1.00
R1954:Clstn3 UTSW 6 124459298 missense possibly damaging 0.94
R2133:Clstn3 UTSW 6 124449503 missense probably benign
R2192:Clstn3 UTSW 6 124459207 missense probably damaging 1.00
R2314:Clstn3 UTSW 6 124450717 missense probably benign 0.39
R2874:Clstn3 UTSW 6 124438335 missense probably damaging 1.00
R3500:Clstn3 UTSW 6 124431711 missense probably benign 0.01
R3761:Clstn3 UTSW 6 124457876 missense possibly damaging 0.54
R3878:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3927:Clstn3 UTSW 6 124451368 missense probably damaging 1.00
R3934:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3935:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R4063:Clstn3 UTSW 6 124449833 missense possibly damaging 0.51
R4402:Clstn3 UTSW 6 124456980 missense probably damaging 0.96
R4534:Clstn3 UTSW 6 124459220 missense probably damaging 1.00
R4785:Clstn3 UTSW 6 124437372 splice site probably null
R4834:Clstn3 UTSW 6 124431953 splice site probably null
R5921:Clstn3 UTSW 6 124431580 utr 3 prime probably benign
R5932:Clstn3 UTSW 6 124438332 missense probably benign 0.01
R6025:Clstn3 UTSW 6 124431664 missense possibly damaging 0.73
R6101:Clstn3 UTSW 6 124461670 missense probably damaging 1.00
R6360:Clstn3 UTSW 6 124438429 missense possibly damaging 0.88
R6578:Clstn3 UTSW 6 124450704 critical splice donor site probably null
R6813:Clstn3 UTSW 6 124436935 missense probably benign 0.00
R7380:Clstn3 UTSW 6 124456989 missense probably benign 0.01
R7419:Clstn3 UTSW 6 124458129 missense probably benign 0.05
R7625:Clstn3 UTSW 6 124437418 nonsense probably null
R7780:Clstn3 UTSW 6 124462202 missense probably damaging 0.98
R7936:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R7939:Clstn3 UTSW 6 124462199 missense probably damaging 1.00
R8047:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R8079:Clstn3 UTSW 6 124459804 missense probably damaging 1.00
R8085:Clstn3 UTSW 6 124458724 missense probably benign 0.23
R8299:Clstn3 UTSW 6 124437373 critical splice donor site probably null
R8406:Clstn3 UTSW 6 124462177 missense probably damaging 1.00
RF014:Clstn3 UTSW 6 124459266 nonsense probably null
X0066:Clstn3 UTSW 6 124449811 missense probably benign 0.13
Z1176:Clstn3 UTSW 6 124459200 missense probably damaging 1.00
Z1177:Clstn3 UTSW 6 124449781 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGAGTCAGAATGTCAGCCCCACC -3'
(R):5'- TCAGCTATGTCTGTGTCTGGGACC -3'

Sequencing Primer
(F):5'- actctggtccaagttcttctac -3'
(R):5'- CTGGGACCCAGGTCCAC -3'
Posted On2013-07-11