Incidental Mutation 'R7059:Fcrls'
ID548114
Institutional Source Beutler Lab
Gene Symbol Fcrls
Ensembl Gene ENSMUSG00000015852
Gene NameFc receptor-like S, scavenger receptor
SynonymsIFGP2, Msr2, Fcrh2, moFcRH2sc, 2810439C17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7059 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location87250758-87263738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87257340 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 293 (I293N)
Ref Sequence ENSEMBL: ENSMUSP00000088508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090986] [ENSMUST00000146512]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090986
AA Change: I293N

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088508
Gene: ENSMUSG00000015852
AA Change: I293N

DomainStartEndE-ValueType
IG 23 106 1.32e-3 SMART
IGc2 122 186 2.77e-6 SMART
IGc2 226 291 1.09e-4 SMART
IG 315 396 1e-3 SMART
SR 402 503 7.29e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146512
SMART Domains Protein: ENSMUSP00000115780
Gene: ENSMUSG00000015852

DomainStartEndE-ValueType
IG 23 106 1.32e-3 SMART
Pfam:Ig_2 111 176 6.1e-6 PFAM
Pfam:Ig_3 111 176 1.4e-4 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Female homozygous mutant mice are larger than controls and show increased mean body weight, total tissue mass, lean body mass and total body fat. Homozygous mutant mice eshow a decreased mean percentage of CD8 cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,574,497 probably benign Het
9930021J03Rik T A 19: 29,719,545 E849D probably benign Het
Abca16 A G 7: 120,421,748 T5A probably benign Het
Abraxas1 T C 5: 100,806,237 D349G probably benign Het
Adcyap1r1 T A 6: 55,491,310 L405Q probably damaging Het
Aqp5 A T 15: 99,594,246 T125S probably benign Het
Asah1 A T 8: 41,347,069 N169K probably damaging Het
Atl3 A G 19: 7,533,968 N515D probably benign Het
Atl3 A C 19: 7,533,969 N520T probably benign Het
Atp6v1c2 C A 12: 17,289,004 E249* probably null Het
Bcl2a1b T A 9: 89,199,760 I134K probably damaging Het
Btbd10 C T 7: 113,329,922 R159H probably damaging Het
Chmp6 T C 11: 119,916,040 F7L probably damaging Het
Colq C A 14: 31,526,034 C409F probably damaging Het
Cpox T A 16: 58,670,927 V167E probably damaging Het
Cul3 T C 1: 80,276,424 Y545C probably benign Het
Dqx1 C T 6: 83,064,809 A544V probably benign Het
Dzip3 A G 16: 48,980,942 I73T probably benign Het
Epha3 T A 16: 63,568,455 Y810F probably damaging Het
Esp36 A T 17: 38,417,051 I113N unknown Het
Fbxw17 T A 13: 50,432,548 W429R probably damaging Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8126 T A 14: 43,261,518 L148H probably benign Het
Gpr39 C A 1: 125,677,959 S208Y probably damaging Het
Heatr5a T C 12: 51,888,234 E1662G probably damaging Het
Hgfac T A 5: 35,044,429 L302Q possibly damaging Het
Itih1 G A 14: 30,931,309 H721Y possibly damaging Het
Kat8 A G 7: 127,924,903 I372V probably benign Het
Kcnk1 T A 8: 126,029,727 Y329* probably null Het
Kcns2 A T 15: 34,838,835 I115F probably damaging Het
Kif1a C T 1: 93,046,829 probably benign Het
Lcn2 T A 2: 32,387,596 D127V possibly damaging Het
Lrfn1 T C 7: 28,466,930 V583A possibly damaging Het
Map3k1 T C 13: 111,772,778 I55V probably benign Het
Mapk9 T C 11: 49,867,047 probably null Het
Mrpl18 A G 17: 12,913,781 S154P possibly damaging Het
Mst1 C A 9: 108,084,064 H524Q probably benign Het
Mtpap T C 18: 4,396,202 L498P probably damaging Het
Myl3 C T 9: 110,742,037 probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Mzf1 G T 7: 13,053,058 S28R probably damaging Het
Olfm1 T C 2: 28,222,616 S205P probably damaging Het
Olfr671 A T 7: 104,976,017 probably null Het
Prrc2a G A 17: 35,157,388 P809S probably damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rbm48 A T 5: 3,590,625 C251* probably null Het
Rxfp1 A T 3: 79,652,269 V415E probably damaging Het
Slc12a6 T A 2: 112,352,912 L748Q probably damaging Het
Slc19a3 T A 1: 83,022,369 Y309F probably damaging Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Slc38a4 G T 15: 97,009,014 S281* probably null Het
Syne1 A T 10: 5,346,859 S1201T probably damaging Het
Tex15 C A 8: 33,574,730 T1396K possibly damaging Het
Zswim8 G T 14: 20,714,573 probably null Het
Other mutations in Fcrls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Fcrls APN 3 87256679 missense probably damaging 0.99
IGL01959:Fcrls APN 3 87259632 missense probably damaging 0.97
IGL02409:Fcrls APN 3 87252723 missense probably benign 0.00
IGL02677:Fcrls APN 3 87259387 missense probably benign 0.01
IGL02957:Fcrls APN 3 87262194 missense possibly damaging 0.59
IGL02974:Fcrls APN 3 87257397 missense possibly damaging 0.89
IGL02992:Fcrls APN 3 87259466 missense probably damaging 0.99
R0052:Fcrls UTSW 3 87256778 missense possibly damaging 0.94
R0052:Fcrls UTSW 3 87256778 missense possibly damaging 0.94
R0131:Fcrls UTSW 3 87258959 missense possibly damaging 0.90
R1171:Fcrls UTSW 3 87256860 missense probably benign 0.24
R1319:Fcrls UTSW 3 87262177 critical splice donor site probably null
R1522:Fcrls UTSW 3 87256707 missense possibly damaging 0.64
R1696:Fcrls UTSW 3 87259518 missense possibly damaging 0.95
R1742:Fcrls UTSW 3 87259043 missense possibly damaging 0.76
R2156:Fcrls UTSW 3 87257341 missense probably benign 0.43
R2255:Fcrls UTSW 3 87257348 nonsense probably null
R2257:Fcrls UTSW 3 87259621 missense probably damaging 0.99
R2434:Fcrls UTSW 3 87256698 missense probably damaging 1.00
R2680:Fcrls UTSW 3 87257349 missense probably damaging 0.99
R3552:Fcrls UTSW 3 87259410 missense possibly damaging 0.73
R4866:Fcrls UTSW 3 87263466 missense possibly damaging 0.65
R4883:Fcrls UTSW 3 87259615 missense possibly damaging 0.48
R5654:Fcrls UTSW 3 87257544 missense probably benign
R5771:Fcrls UTSW 3 87263468 missense probably damaging 0.98
R5917:Fcrls UTSW 3 87256787 missense probably damaging 0.99
R6349:Fcrls UTSW 3 87252496 missense probably damaging 0.99
R6562:Fcrls UTSW 3 87257328 missense probably benign
R6954:Fcrls UTSW 3 87263676 critical splice donor site probably benign
R7188:Fcrls UTSW 3 87259523 missense probably benign 0.13
R7201:Fcrls UTSW 3 87252627 missense probably damaging 0.99
R7369:Fcrls UTSW 3 87256701 missense possibly damaging 0.59
R7431:Fcrls UTSW 3 87258926 missense probably damaging 0.99
R7610:Fcrls UTSW 3 87252697 missense probably damaging 1.00
R8018:Fcrls UTSW 3 87259626 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGCCACTTTGACACCCAC -3'
(R):5'- TGGAGATCCAGCCTTCAAGAG -3'

Sequencing Primer
(F):5'- CTTTGACACCCACCGACC -3'
(R):5'- AGCCACTGGTCGTTGAAG -3'
Posted On2019-05-13