Incidental Mutation 'R7059:Lrfn1'
ID548122
Institutional Source Beutler Lab
Gene Symbol Lrfn1
Ensembl Gene ENSMUSG00000030600
Gene Nameleucine rich repeat and fibronectin type III domain containing 1
SynonymsSALM2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R7059 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28451980-28468242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28466930 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 583 (V583A)
Ref Sequence ENSEMBL: ENSMUSP00000103923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040531] [ENSMUST00000055110] [ENSMUST00000108288] [ENSMUST00000189877]
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055110
SMART Domains Protein: ENSMUSP00000057645
Gene: ENSMUSG00000030600

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108288
AA Change: V583A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103923
Gene: ENSMUSG00000030600
AA Change: V583A

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
FN3 422 502 2.68e-2 SMART
transmembrane domain 535 557 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 609 625 N/A INTRINSIC
low complexity region 716 725 N/A INTRINSIC
low complexity region 730 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189877
SMART Domains Protein: ENSMUSP00000139609
Gene: ENSMUSG00000030600

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,574,497 probably benign Het
9930021J03Rik T A 19: 29,719,545 E849D probably benign Het
Abca16 A G 7: 120,421,748 T5A probably benign Het
Abraxas1 T C 5: 100,806,237 D349G probably benign Het
Adcyap1r1 T A 6: 55,491,310 L405Q probably damaging Het
Aqp5 A T 15: 99,594,246 T125S probably benign Het
Asah1 A T 8: 41,347,069 N169K probably damaging Het
Atl3 A G 19: 7,533,968 N515D probably benign Het
Atl3 A C 19: 7,533,969 N520T probably benign Het
Atp6v1c2 C A 12: 17,289,004 E249* probably null Het
Bcl2a1b T A 9: 89,199,760 I134K probably damaging Het
Btbd10 C T 7: 113,329,922 R159H probably damaging Het
Chmp6 T C 11: 119,916,040 F7L probably damaging Het
Colq C A 14: 31,526,034 C409F probably damaging Het
Cpox T A 16: 58,670,927 V167E probably damaging Het
Cul3 T C 1: 80,276,424 Y545C probably benign Het
Dqx1 C T 6: 83,064,809 A544V probably benign Het
Dzip3 A G 16: 48,980,942 I73T probably benign Het
Epha3 T A 16: 63,568,455 Y810F probably damaging Het
Esp36 A T 17: 38,417,051 I113N unknown Het
Fbxw17 T A 13: 50,432,548 W429R probably damaging Het
Fcrls A T 3: 87,257,340 I293N possibly damaging Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8126 T A 14: 43,261,518 L148H probably benign Het
Gpr39 C A 1: 125,677,959 S208Y probably damaging Het
Heatr5a T C 12: 51,888,234 E1662G probably damaging Het
Hgfac T A 5: 35,044,429 L302Q possibly damaging Het
Itih1 G A 14: 30,931,309 H721Y possibly damaging Het
Kat8 A G 7: 127,924,903 I372V probably benign Het
Kcnk1 T A 8: 126,029,727 Y329* probably null Het
Kcns2 A T 15: 34,838,835 I115F probably damaging Het
Kif1a C T 1: 93,046,829 probably benign Het
Lcn2 T A 2: 32,387,596 D127V possibly damaging Het
Map3k1 T C 13: 111,772,778 I55V probably benign Het
Mapk9 T C 11: 49,867,047 probably null Het
Mrpl18 A G 17: 12,913,781 S154P possibly damaging Het
Mst1 C A 9: 108,084,064 H524Q probably benign Het
Mtpap T C 18: 4,396,202 L498P probably damaging Het
Myl3 C T 9: 110,742,037 probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Mzf1 G T 7: 13,053,058 S28R probably damaging Het
Olfm1 T C 2: 28,222,616 S205P probably damaging Het
Olfr671 A T 7: 104,976,017 probably null Het
Prrc2a G A 17: 35,157,388 P809S probably damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rbm48 A T 5: 3,590,625 C251* probably null Het
Rxfp1 A T 3: 79,652,269 V415E probably damaging Het
Slc12a6 T A 2: 112,352,912 L748Q probably damaging Het
Slc19a3 T A 1: 83,022,369 Y309F probably damaging Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Slc38a4 G T 15: 97,009,014 S281* probably null Het
Syne1 A T 10: 5,346,859 S1201T probably damaging Het
Tex15 C A 8: 33,574,730 T1396K possibly damaging Het
Zswim8 G T 14: 20,714,573 probably null Het
Other mutations in Lrfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Lrfn1 APN 7 28460017 missense probably damaging 1.00
IGL01565:Lrfn1 APN 7 28458769 missense probably damaging 1.00
IGL01622:Lrfn1 APN 7 28466686 missense probably damaging 1.00
IGL01623:Lrfn1 APN 7 28466686 missense probably damaging 1.00
IGL02176:Lrfn1 APN 7 28458686 intron probably benign
IGL02642:Lrfn1 APN 7 28458688 intron probably benign
R1123:Lrfn1 UTSW 7 28467119 missense possibly damaging 0.71
R1838:Lrfn1 UTSW 7 28459768 missense probably damaging 0.98
R3000:Lrfn1 UTSW 7 28467407 missense probably damaging 1.00
R3551:Lrfn1 UTSW 7 28460054 missense possibly damaging 0.90
R3905:Lrfn1 UTSW 7 28466869 missense possibly damaging 0.49
R4246:Lrfn1 UTSW 7 28459942 missense probably benign 0.03
R5621:Lrfn1 UTSW 7 28466836 missense probably damaging 1.00
R6267:Lrfn1 UTSW 7 28459744 missense probably benign 0.01
R6902:Lrfn1 UTSW 7 28459813 missense probably benign 0.10
R7073:Lrfn1 UTSW 7 28459972 missense possibly damaging 0.94
R7208:Lrfn1 UTSW 7 28467139 missense probably benign
R7402:Lrfn1 UTSW 7 28459522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGCAATTCACCACCG -3'
(R):5'- AGATTCCTCCCCAGAAGTTTCC -3'

Sequencing Primer
(F):5'- ATTCACCACCGCGGGAGATC -3'
(R):5'- TCCCCAGAAGTTTCCTCGGAG -3'
Posted On2019-05-13