Incidental Mutation 'R7059:Kat8'
ID548125
Institutional Source Beutler Lab
Gene Symbol Kat8
Ensembl Gene ENSMUSG00000030801
Gene NameK(lysine) acetyltransferase 8
Synonyms5830450F21Rik, 2010203C02Rik, Myst1, MOF, D7Ertd629e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7059 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127912516-127925837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127924903 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 372 (I372V)
Ref Sequence ENSEMBL: ENSMUSP00000033070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032988] [ENSMUST00000033070] [ENSMUST00000205357] [ENSMUST00000206124] [ENSMUST00000206568]
PDB Structure
Solution Structure of the Tudor Domain from Mouse Hypothetical Protein Homologous to Histone Acetyltransferase [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000032988
SMART Domains Protein: ENSMUSP00000032988
Gene: ENSMUSG00000030800

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Tryp_SPc 44 281 3.55e-98 SMART
low complexity region 320 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033070
AA Change: I372V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033070
Gene: ENSMUSG00000030801
AA Change: I372V

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
CHROMO 69 123 6.6e-8 SMART
Blast:PHD 177 214 4e-6 BLAST
Pfam:MOZ_SAS 235 412 5.7e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205357
Predicted Effect probably benign
Transcript: ENSMUST00000206124
Predicted Effect probably benign
Transcript: ENSMUST00000206568
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MYST histone acetylase protein family. The encoded protein has a characteristic MYST domain containing an acetyl-CoA-binding site, a chromodomain typical of proteins which bind histones, and a C2HC-type zinc finger. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele die prior to gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,574,497 probably benign Het
9930021J03Rik T A 19: 29,719,545 E849D probably benign Het
Abca16 A G 7: 120,421,748 T5A probably benign Het
Abraxas1 T C 5: 100,806,237 D349G probably benign Het
Adcyap1r1 T A 6: 55,491,310 L405Q probably damaging Het
Aqp5 A T 15: 99,594,246 T125S probably benign Het
Asah1 A T 8: 41,347,069 N169K probably damaging Het
Atl3 A G 19: 7,533,968 N515D probably benign Het
Atl3 A C 19: 7,533,969 N520T probably benign Het
Atp6v1c2 C A 12: 17,289,004 E249* probably null Het
Bcl2a1b T A 9: 89,199,760 I134K probably damaging Het
Btbd10 C T 7: 113,329,922 R159H probably damaging Het
Chmp6 T C 11: 119,916,040 F7L probably damaging Het
Colq C A 14: 31,526,034 C409F probably damaging Het
Cpox T A 16: 58,670,927 V167E probably damaging Het
Cul3 T C 1: 80,276,424 Y545C probably benign Het
Dqx1 C T 6: 83,064,809 A544V probably benign Het
Dzip3 A G 16: 48,980,942 I73T probably benign Het
Epha3 T A 16: 63,568,455 Y810F probably damaging Het
Esp36 A T 17: 38,417,051 I113N unknown Het
Fbxw17 T A 13: 50,432,548 W429R probably damaging Het
Fcrls A T 3: 87,257,340 I293N possibly damaging Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8126 T A 14: 43,261,518 L148H probably benign Het
Gpr39 C A 1: 125,677,959 S208Y probably damaging Het
Heatr5a T C 12: 51,888,234 E1662G probably damaging Het
Hgfac T A 5: 35,044,429 L302Q possibly damaging Het
Itih1 G A 14: 30,931,309 H721Y possibly damaging Het
Kcnk1 T A 8: 126,029,727 Y329* probably null Het
Kcns2 A T 15: 34,838,835 I115F probably damaging Het
Kif1a C T 1: 93,046,829 probably benign Het
Lcn2 T A 2: 32,387,596 D127V possibly damaging Het
Lrfn1 T C 7: 28,466,930 V583A possibly damaging Het
Map3k1 T C 13: 111,772,778 I55V probably benign Het
Mapk9 T C 11: 49,867,047 probably null Het
Mrpl18 A G 17: 12,913,781 S154P possibly damaging Het
Mst1 C A 9: 108,084,064 H524Q probably benign Het
Mtpap T C 18: 4,396,202 L498P probably damaging Het
Myl3 C T 9: 110,742,037 probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Mzf1 G T 7: 13,053,058 S28R probably damaging Het
Olfm1 T C 2: 28,222,616 S205P probably damaging Het
Olfr671 A T 7: 104,976,017 probably null Het
Prrc2a G A 17: 35,157,388 P809S probably damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rbm48 A T 5: 3,590,625 C251* probably null Het
Rxfp1 A T 3: 79,652,269 V415E probably damaging Het
Slc12a6 T A 2: 112,352,912 L748Q probably damaging Het
Slc19a3 T A 1: 83,022,369 Y309F probably damaging Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Slc38a4 G T 15: 97,009,014 S281* probably null Het
Syne1 A T 10: 5,346,859 S1201T probably damaging Het
Tex15 C A 8: 33,574,730 T1396K possibly damaging Het
Zswim8 G T 14: 20,714,573 probably null Het
Other mutations in Kat8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Kat8 APN 7 127920504 missense probably damaging 1.00
R0853:Kat8 UTSW 7 127925224 missense probably benign 0.12
R1293:Kat8 UTSW 7 127922250 critical splice donor site probably null
R1926:Kat8 UTSW 7 127915295 nonsense probably null
R3824:Kat8 UTSW 7 127924482 missense possibly damaging 0.56
R4841:Kat8 UTSW 7 127925194 missense probably benign 0.11
R4892:Kat8 UTSW 7 127915538 missense possibly damaging 0.68
R5102:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5104:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5722:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5723:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5724:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5734:Kat8 UTSW 7 127920579 missense probably benign 0.00
R5820:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R5821:Kat8 UTSW 7 127924816 missense probably damaging 1.00
R7158:Kat8 UTSW 7 127922159 missense probably benign
X0027:Kat8 UTSW 7 127925258 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGCCTAGGATGTGGGTACTG -3'
(R):5'- ATCTGGCTGTAGAGAAGGATTCG -3'

Sequencing Primer
(F):5'- CCTAGGATGTGGGTACTGGAGTTG -3'
(R):5'- TTCGAGCATATGGAATCAATGAAG -3'
Posted On2019-05-13