Mutagenetix > Incidental Mutations

Incidental Mutation 'R7059:Kat8'

548125

Institutional Source

Beutler Lab

Gene Symbol

Kat8

Ensembl Gene

ENSMUSG00000030801

Gene Name

K(lysine) acetyltransferase 8

Synonyms

5830450F21Rik, 2010203C02Rik, Myst1, MOF, D7Ertd629e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7059 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127912516-127925837 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127924903 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 372 (I372V)

Ref Sequence

ENSEMBL: ENSMUSP00000033070 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032988] [ENSMUST00000033070] [ENSMUST00000205357] [ENSMUST00000206124] [ENSMUST00000206568]

PDB Structure

Solution Structure of the Tudor Domain from Mouse Hypothetical Protein Homologous to Histone Acetyltransferase [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000032988

SMART Domains

Protein: ENSMUSP00000032988
Gene: ENSMUSG00000030800

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Tryp_SPc	44	281	3.55e-98	SMART
low complexity region	320	338	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000033070
AA Change: I372V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000033070
Gene: ENSMUSG00000030801
AA Change: I372V

Domain	Start	End	E-Value	Type
low complexity region	2	35	N/A	INTRINSIC
CHROMO	69	123	6.6e-8	SMART
Blast:PHD	177	214	4e-6	BLAST
Pfam:MOZ_SAS	235	412	5.7e-90	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205357

Predicted Effect

probably benign
Transcript: ENSMUST00000206124

Predicted Effect

probably benign
Transcript: ENSMUST00000206568

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MYST histone acetylase protein family. The encoded protein has a characteristic MYST domain containing an acetyl-CoA-binding site, a chromodomain typical of proteins which bind histones, and a C2HC-type zinc finger. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele die prior to gastrulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430097D07Rik	T	C	2: 32,574,497		probably benign	Het
9930021J03Rik	T	A	19: 29,719,545	E849D	probably benign	Het
Abca16	A	G	7: 120,421,748	T5A	probably benign	Het
Abraxas1	T	C	5: 100,806,237	D349G	probably benign	Het
Adcyap1r1	T	A	6: 55,491,310	L405Q	probably damaging	Het
Aqp5	A	T	15: 99,594,246	T125S	probably benign	Het
Asah1	A	T	8: 41,347,069	N169K	probably damaging	Het
Atl3	A	G	19: 7,533,968	N515D	probably benign	Het
Atl3	A	C	19: 7,533,969	N520T	probably benign	Het
Atp6v1c2	C	A	12: 17,289,004	E249*	probably null	Het
Bcl2a1b	T	A	9: 89,199,760	I134K	probably damaging	Het
Btbd10	C	T	7: 113,329,922	R159H	probably damaging	Het
Chmp6	T	C	11: 119,916,040	F7L	probably damaging	Het
Colq	C	A	14: 31,526,034	C409F	probably damaging	Het
Cpox	T	A	16: 58,670,927	V167E	probably damaging	Het
Cul3	T	C	1: 80,276,424	Y545C	probably benign	Het
Dqx1	C	T	6: 83,064,809	A544V	probably benign	Het
Dzip3	A	G	16: 48,980,942	I73T	probably benign	Het
Epha3	T	A	16: 63,568,455	Y810F	probably damaging	Het
Esp36	A	T	17: 38,417,051	I113N	unknown	Het
Fbxw17	T	A	13: 50,432,548	W429R	probably damaging	Het
Fcrls	A	T	3: 87,257,340	I293N	possibly damaging	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Gm8126	T	A	14: 43,261,518	L148H	probably benign	Het
Gpr39	C	A	1: 125,677,959	S208Y	probably damaging	Het
Heatr5a	T	C	12: 51,888,234	E1662G	probably damaging	Het
Hgfac	T	A	5: 35,044,429	L302Q	possibly damaging	Het
Itih1	G	A	14: 30,931,309	H721Y	possibly damaging	Het
Kcnk1	T	A	8: 126,029,727	Y329*	probably null	Het
Kcns2	A	T	15: 34,838,835	I115F	probably damaging	Het
Kif1a	C	T	1: 93,046,829		probably benign	Het
Lcn2	T	A	2: 32,387,596	D127V	possibly damaging	Het
Lrfn1	T	C	7: 28,466,930	V583A	possibly damaging	Het
Map3k1	T	C	13: 111,772,778	I55V	probably benign	Het
Mapk9	T	C	11: 49,867,047		probably null	Het
Mrpl18	A	G	17: 12,913,781	S154P	possibly damaging	Het
Mst1	C	A	9: 108,084,064	H524Q	probably benign	Het
Mtpap	T	C	18: 4,396,202	L498P	probably damaging	Het
Myl3	C	T	9: 110,742,037		probably benign	Het
Myrfl	T	C	10: 116,849,206	T90A	probably benign	Het
Mzf1	G	T	7: 13,053,058	S28R	probably damaging	Het
Olfm1	T	C	2: 28,222,616	S205P	probably damaging	Het
Olfr671	A	T	7: 104,976,017		probably null	Het
Prrc2a	G	A	17: 35,157,388	P809S	probably damaging	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rbm48	A	T	5: 3,590,625	C251*	probably null	Het
Rxfp1	A	T	3: 79,652,269	V415E	probably damaging	Het
Slc12a6	T	A	2: 112,352,912	L748Q	probably damaging	Het
Slc19a3	T	A	1: 83,022,369	Y309F	probably damaging	Het
Slc36a1	A	G	11: 55,223,672	D192G	probably damaging	Het
Slc38a4	G	T	15: 97,009,014	S281*	probably null	Het
Syne1	A	T	10: 5,346,859	S1201T	probably damaging	Het
Tex15	C	A	8: 33,574,730	T1396K	possibly damaging	Het
Zswim8	G	T	14: 20,714,573		probably null	Het

Other mutations in Kat8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Kat8	APN	7	127920504	missense	probably damaging	1.00
R0853:Kat8	UTSW	7	127925224	missense	probably benign	0.12
R1293:Kat8	UTSW	7	127922250	critical splice donor site	probably null
R1926:Kat8	UTSW	7	127915295	nonsense	probably null
R3824:Kat8	UTSW	7	127924482	missense	possibly damaging	0.56
R4841:Kat8	UTSW	7	127925194	missense	probably benign	0.11
R4892:Kat8	UTSW	7	127915538	missense	possibly damaging	0.68
R5102:Kat8	UTSW	7	127924816	missense	probably damaging	1.00
R5104:Kat8	UTSW	7	127924816	missense	probably damaging	1.00
R5722:Kat8	UTSW	7	127924816	missense	probably damaging	1.00
R5723:Kat8	UTSW	7	127924816	missense	probably damaging	1.00
R5724:Kat8	UTSW	7	127924816	missense	probably damaging	1.00
R5734:Kat8	UTSW	7	127920579	missense	probably benign	0.00
R5820:Kat8	UTSW	7	127924816	missense	probably damaging	1.00
R5821:Kat8	UTSW	7	127924816	missense	probably damaging	1.00
R7158:Kat8	UTSW	7	127922159	missense	probably benign
R8263:Kat8	UTSW	7	127924481	missense	possibly damaging	0.94
X0027:Kat8	UTSW	7	127925258	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCCTAGGATGTGGGTACTG -3'
(R):5'- ATCTGGCTGTAGAGAAGGATTCG -3'

Sequencing Primer
(F):5'- CCTAGGATGTGGGTACTGGAGTTG -3'
(R):5'- TTCGAGCATATGGAATCAATGAAG -3'

Posted On

2019-05-13