Incidental Mutation 'R7059:Myrfl'
ID548133
Institutional Source Beutler Lab
Gene Symbol Myrfl
Ensembl Gene ENSMUSG00000034057
Gene Namemyelin regulatory factor-like
SynonymsLOC237558, Gm239
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7059 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location116776535-116896919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116849206 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 90 (T90A)
Ref Sequence ENSEMBL: ENSMUSP00000037477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048229]
Predicted Effect probably benign
Transcript: ENSMUST00000048229
AA Change: T90A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037477
Gene: ENSMUSG00000034057
AA Change: T90A

DomainStartEndE-ValueType
Pfam:NDT80_PhoG 252 399 3.4e-29 PFAM
Pfam:Peptidase_S74 446 505 1.6e-18 PFAM
Pfam:MRF_C1 525 560 1.8e-24 PFAM
low complexity region 562 601 N/A INTRINSIC
transmembrane domain 625 647 N/A INTRINSIC
low complexity region 663 691 N/A INTRINSIC
Pfam:MRF_C2 765 903 4e-53 PFAM
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,574,497 probably benign Het
9930021J03Rik T A 19: 29,719,545 E849D probably benign Het
Abca16 A G 7: 120,421,748 T5A probably benign Het
Abraxas1 T C 5: 100,806,237 D349G probably benign Het
Adcyap1r1 T A 6: 55,491,310 L405Q probably damaging Het
Aqp5 A T 15: 99,594,246 T125S probably benign Het
Asah1 A T 8: 41,347,069 N169K probably damaging Het
Atl3 A G 19: 7,533,968 N515D probably benign Het
Atl3 A C 19: 7,533,969 N520T probably benign Het
Atp6v1c2 C A 12: 17,289,004 E249* probably null Het
Bcl2a1b T A 9: 89,199,760 I134K probably damaging Het
Btbd10 C T 7: 113,329,922 R159H probably damaging Het
Chmp6 T C 11: 119,916,040 F7L probably damaging Het
Colq C A 14: 31,526,034 C409F probably damaging Het
Cpox T A 16: 58,670,927 V167E probably damaging Het
Cul3 T C 1: 80,276,424 Y545C probably benign Het
Dqx1 C T 6: 83,064,809 A544V probably benign Het
Dzip3 A G 16: 48,980,942 I73T probably benign Het
Epha3 T A 16: 63,568,455 Y810F probably damaging Het
Esp36 A T 17: 38,417,051 I113N unknown Het
Fbxw17 T A 13: 50,432,548 W429R probably damaging Het
Fcrls A T 3: 87,257,340 I293N possibly damaging Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8126 T A 14: 43,261,518 L148H probably benign Het
Gpr39 C A 1: 125,677,959 S208Y probably damaging Het
Heatr5a T C 12: 51,888,234 E1662G probably damaging Het
Hgfac T A 5: 35,044,429 L302Q possibly damaging Het
Itih1 G A 14: 30,931,309 H721Y possibly damaging Het
Kat8 A G 7: 127,924,903 I372V probably benign Het
Kcnk1 T A 8: 126,029,727 Y329* probably null Het
Kcns2 A T 15: 34,838,835 I115F probably damaging Het
Kif1a C T 1: 93,046,829 probably benign Het
Lcn2 T A 2: 32,387,596 D127V possibly damaging Het
Lrfn1 T C 7: 28,466,930 V583A possibly damaging Het
Map3k1 T C 13: 111,772,778 I55V probably benign Het
Mapk9 T C 11: 49,867,047 probably null Het
Mrpl18 A G 17: 12,913,781 S154P possibly damaging Het
Mst1 C A 9: 108,084,064 H524Q probably benign Het
Mtpap T C 18: 4,396,202 L498P probably damaging Het
Myl3 C T 9: 110,742,037 probably benign Het
Mzf1 G T 7: 13,053,058 S28R probably damaging Het
Olfm1 T C 2: 28,222,616 S205P probably damaging Het
Olfr671 A T 7: 104,976,017 probably null Het
Prrc2a G A 17: 35,157,388 P809S probably damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rbm48 A T 5: 3,590,625 C251* probably null Het
Rxfp1 A T 3: 79,652,269 V415E probably damaging Het
Slc12a6 T A 2: 112,352,912 L748Q probably damaging Het
Slc19a3 T A 1: 83,022,369 Y309F probably damaging Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Slc38a4 G T 15: 97,009,014 S281* probably null Het
Syne1 A T 10: 5,346,859 S1201T probably damaging Het
Tex15 C A 8: 33,574,730 T1396K possibly damaging Het
Zswim8 G T 14: 20,714,573 probably null Het
Other mutations in Myrfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Myrfl APN 10 116796106 missense possibly damaging 0.46
IGL00824:Myrfl APN 10 116849359 splice site probably benign
IGL01074:Myrfl APN 10 116779585 missense possibly damaging 0.50
IGL01394:Myrfl APN 10 116822687 missense probably benign 0.01
IGL02283:Myrfl APN 10 116777360 missense probably benign 0.33
IGL02869:Myrfl APN 10 116829004 missense probably damaging 0.98
IGL02878:Myrfl APN 10 116777405 missense possibly damaging 0.70
IGL03112:Myrfl APN 10 116803406 missense probably benign 0.03
F5770:Myrfl UTSW 10 116861530 missense probably damaging 1.00
R0138:Myrfl UTSW 10 116849233 missense probably damaging 0.98
R0402:Myrfl UTSW 10 116828977 missense probably damaging 1.00
R0554:Myrfl UTSW 10 116828973 missense probably damaging 1.00
R0601:Myrfl UTSW 10 116776760 missense probably damaging 1.00
R0790:Myrfl UTSW 10 116817788 missense probably damaging 0.99
R0831:Myrfl UTSW 10 116783209 missense probably benign 0.06
R0931:Myrfl UTSW 10 116839449 missense probably benign 0.01
R0945:Myrfl UTSW 10 116803394 splice site probably benign
R1078:Myrfl UTSW 10 116776732 missense possibly damaging 0.94
R1187:Myrfl UTSW 10 116831542 missense probably damaging 1.00
R1329:Myrfl UTSW 10 116777342 critical splice donor site probably null
R1432:Myrfl UTSW 10 116777427 missense probably damaging 1.00
R1762:Myrfl UTSW 10 116798593 missense probably damaging 1.00
R1827:Myrfl UTSW 10 116832947 missense probably damaging 0.99
R1952:Myrfl UTSW 10 116822811 missense probably benign 0.00
R2138:Myrfl UTSW 10 116795538 missense probably benign 0.00
R2317:Myrfl UTSW 10 116839384 missense possibly damaging 0.77
R2930:Myrfl UTSW 10 116817747 missense probably damaging 1.00
R3405:Myrfl UTSW 10 116822865 missense probably damaging 1.00
R4118:Myrfl UTSW 10 116828965 missense probably damaging 1.00
R4700:Myrfl UTSW 10 116777342 critical splice donor site probably null
R5039:Myrfl UTSW 10 116822711 missense probably damaging 1.00
R5097:Myrfl UTSW 10 116817704 missense probably damaging 1.00
R5138:Myrfl UTSW 10 116796058 critical splice donor site probably null
R5211:Myrfl UTSW 10 116798630 missense probably benign 0.00
R5249:Myrfl UTSW 10 116783233 missense probably benign
R5573:Myrfl UTSW 10 116822756 missense probably damaging 0.98
R6033:Myrfl UTSW 10 116849101 missense probably benign
R6033:Myrfl UTSW 10 116849101 missense probably benign
R6091:Myrfl UTSW 10 116849206 missense probably benign
R6315:Myrfl UTSW 10 116822819 missense possibly damaging 0.81
R6812:Myrfl UTSW 10 116832913 missense probably damaging 1.00
R6867:Myrfl UTSW 10 116848282 nonsense probably null
R7019:Myrfl UTSW 10 116781947 critical splice donor site probably null
R7181:Myrfl UTSW 10 116861543 missense probably damaging 0.96
R7471:Myrfl UTSW 10 116861512 missense possibly damaging 0.95
R7574:Myrfl UTSW 10 116831525 nonsense probably null
R7584:Myrfl UTSW 10 116828997 missense probably damaging 1.00
R7667:Myrfl UTSW 10 116839353 missense possibly damaging 0.88
R7801:Myrfl UTSW 10 116848335 missense probably benign
V7582:Myrfl UTSW 10 116861530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGATGCTGAAGTGATTCCAAAC -3'
(R):5'- CTCCACAGGTCAAAGGTGAG -3'

Sequencing Primer
(F):5'- ATGCTTTACCCAGGAACGTG -3'
(R):5'- GTGAGTGAGTCCATCCACATAGC -3'
Posted On2019-05-13