Mutagenetix > Incidental Mutations

Incidental Mutation 'R7059:Atp6v1c2'

548137

Institutional Source

Beutler Lab

Gene Symbol

Atp6v1c2

Ensembl Gene

ENSMUSG00000020566

Gene Name

ATPase, H+ transporting, lysosomal V1 subunit C2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R7059 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

17284721-17329359 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 17289004 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 249 (E249*)

Ref Sequence

ENSEMBL: ENSMUSP00000117139 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020884] [ENSMUST00000057288] [ENSMUST00000095820] [ENSMUST00000140751] [ENSMUST00000156727] [ENSMUST00000221129]

Predicted Effect

probably null
Transcript: ENSMUST00000020884
AA Change: E329*

SMART Domains

Protein: ENSMUSP00000020884
Gene: ENSMUSG00000020566
AA Change: E329*

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_C	4	427	3.9e-156	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000057288

SMART Domains

Protein: ENSMUSP00000052912
Gene: ENSMUSG00000020571

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	31	134	5.6e-32	PFAM
low complexity region	143	159	N/A	INTRINSIC
Pfam:Thioredoxin	166	272	7.4e-33	PFAM
low complexity region	427	445	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000095820
AA Change: E319*

SMART Domains

Protein: ENSMUSP00000093500
Gene: ENSMUSG00000020566
AA Change: E319*

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_C	4	417	3.4e-165	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140751

SMART Domains

Protein: ENSMUSP00000123415
Gene: ENSMUSG00000020566

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_C	4	133	4.1e-49	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000156727
AA Change: E249*

SMART Domains

Protein: ENSMUSP00000117139
Gene: ENSMUSG00000020566
AA Change: E249*

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_C	1	347	2.5e-135	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221129

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A,three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain C subunit isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430097D07Rik	T	C	2: 32,574,497		probably benign	Het
9930021J03Rik	T	A	19: 29,719,545	E849D	probably benign	Het
Abca16	A	G	7: 120,421,748	T5A	probably benign	Het
Abraxas1	T	C	5: 100,806,237	D349G	probably benign	Het
Adcyap1r1	T	A	6: 55,491,310	L405Q	probably damaging	Het
Aqp5	A	T	15: 99,594,246	T125S	probably benign	Het
Asah1	A	T	8: 41,347,069	N169K	probably damaging	Het
Atl3	A	G	19: 7,533,968	N515D	probably benign	Het
Atl3	A	C	19: 7,533,969	N520T	probably benign	Het
Bcl2a1b	T	A	9: 89,199,760	I134K	probably damaging	Het
Btbd10	C	T	7: 113,329,922	R159H	probably damaging	Het
Chmp6	T	C	11: 119,916,040	F7L	probably damaging	Het
Colq	C	A	14: 31,526,034	C409F	probably damaging	Het
Cpox	T	A	16: 58,670,927	V167E	probably damaging	Het
Cul3	T	C	1: 80,276,424	Y545C	probably benign	Het
Dqx1	C	T	6: 83,064,809	A544V	probably benign	Het
Dzip3	A	G	16: 48,980,942	I73T	probably benign	Het
Epha3	T	A	16: 63,568,455	Y810F	probably damaging	Het
Esp36	A	T	17: 38,417,051	I113N	unknown	Het
Fbxw17	T	A	13: 50,432,548	W429R	probably damaging	Het
Fcrls	A	T	3: 87,257,340	I293N	possibly damaging	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Gm8126	T	A	14: 43,261,518	L148H	probably benign	Het
Gpr39	C	A	1: 125,677,959	S208Y	probably damaging	Het
Heatr5a	T	C	12: 51,888,234	E1662G	probably damaging	Het
Hgfac	T	A	5: 35,044,429	L302Q	possibly damaging	Het
Itih1	G	A	14: 30,931,309	H721Y	possibly damaging	Het
Kat8	A	G	7: 127,924,903	I372V	probably benign	Het
Kcnk1	T	A	8: 126,029,727	Y329*	probably null	Het
Kcns2	A	T	15: 34,838,835	I115F	probably damaging	Het
Kif1a	C	T	1: 93,046,829		probably benign	Het
Lcn2	T	A	2: 32,387,596	D127V	possibly damaging	Het
Lrfn1	T	C	7: 28,466,930	V583A	possibly damaging	Het
Map3k1	T	C	13: 111,772,778	I55V	probably benign	Het
Mapk9	T	C	11: 49,867,047		probably null	Het
Mrpl18	A	G	17: 12,913,781	S154P	possibly damaging	Het
Mst1	C	A	9: 108,084,064	H524Q	probably benign	Het
Mtpap	T	C	18: 4,396,202	L498P	probably damaging	Het
Myl3	C	T	9: 110,742,037		probably benign	Het
Myrfl	T	C	10: 116,849,206	T90A	probably benign	Het
Mzf1	G	T	7: 13,053,058	S28R	probably damaging	Het
Olfm1	T	C	2: 28,222,616	S205P	probably damaging	Het
Olfr671	A	T	7: 104,976,017		probably null	Het
Prrc2a	G	A	17: 35,157,388	P809S	probably damaging	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rbm48	A	T	5: 3,590,625	C251*	probably null	Het
Rxfp1	A	T	3: 79,652,269	V415E	probably damaging	Het
Slc12a6	T	A	2: 112,352,912	L748Q	probably damaging	Het
Slc19a3	T	A	1: 83,022,369	Y309F	probably damaging	Het
Slc36a1	A	G	11: 55,223,672	D192G	probably damaging	Het
Slc38a4	G	T	15: 97,009,014	S281*	probably null	Het
Syne1	A	T	10: 5,346,859	S1201T	probably damaging	Het
Tex15	C	A	8: 33,574,730	T1396K	possibly damaging	Het
Zswim8	G	T	14: 20,714,573		probably null	Het

Other mutations in Atp6v1c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01120:Atp6v1c2	APN	12	17308293	missense	probably damaging	1.00
IGL01520:Atp6v1c2	APN	12	17297753	missense	probably damaging	1.00
IGL02121:Atp6v1c2	APN	12	17291440	missense	possibly damaging	0.65
IGL02990:Atp6v1c2	APN	12	17294740	missense	probably damaging	1.00
IGL03243:Atp6v1c2	APN	12	17289121	missense	probably benign	0.07
R0077:Atp6v1c2	UTSW	12	17321612	missense	probably damaging	1.00
R0239:Atp6v1c2	UTSW	12	17294675	critical splice donor site	probably null
R0239:Atp6v1c2	UTSW	12	17294675	critical splice donor site	probably null
R0358:Atp6v1c2	UTSW	12	17284960	splice site	probably benign
R0373:Atp6v1c2	UTSW	12	17288168	missense	probably damaging	1.00
R0536:Atp6v1c2	UTSW	12	17307508	splice site	probably null
R1164:Atp6v1c2	UTSW	12	17308316	missense	probably damaging	1.00
R1400:Atp6v1c2	UTSW	12	17289130	missense	probably benign	0.13
R2133:Atp6v1c2	UTSW	12	17321611	missense	probably benign	0.03
R4695:Atp6v1c2	UTSW	12	17301207	missense	probably benign	0.02
R4825:Atp6v1c2	UTSW	12	17289060	missense	probably benign	0.02
R5215:Atp6v1c2	UTSW	12	17291658	missense	probably benign	0.08
R6034:Atp6v1c2	UTSW	12	17307500	missense	possibly damaging	0.79
R6034:Atp6v1c2	UTSW	12	17307500	missense	possibly damaging	0.79
R6196:Atp6v1c2	UTSW	12	17301186	nonsense	probably null
R7505:Atp6v1c2	UTSW	12	17297723	splice site	probably null
R7559:Atp6v1c2	UTSW	12	17301214	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- CTCCAGAAAGTCCATGAAGGTTAG -3'
(R):5'- GGATTCCAGAGCTTGCTTGC -3'

Sequencing Primer
(F):5'- TTAGGACAGCAGGATTCTAGGCTC -3'
(R):5'- CCCAGGCCATGAGAATTATTTGTG -3'

Posted On

2019-05-13