Incidental Mutation 'R7059:Atp6v1c2'
ID548137
Institutional Source Beutler Lab
Gene Symbol Atp6v1c2
Ensembl Gene ENSMUSG00000020566
Gene NameATPase, H+ transporting, lysosomal V1 subunit C2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R7059 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location17284721-17329359 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 17289004 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 249 (E249*)
Ref Sequence ENSEMBL: ENSMUSP00000117139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020884] [ENSMUST00000057288] [ENSMUST00000095820] [ENSMUST00000140751] [ENSMUST00000156727] [ENSMUST00000221129]
Predicted Effect probably null
Transcript: ENSMUST00000020884
AA Change: E329*
SMART Domains Protein: ENSMUSP00000020884
Gene: ENSMUSG00000020566
AA Change: E329*

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 427 3.9e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057288
SMART Domains Protein: ENSMUSP00000052912
Gene: ENSMUSG00000020571

DomainStartEndE-ValueType
Pfam:Thioredoxin 31 134 5.6e-32 PFAM
low complexity region 143 159 N/A INTRINSIC
Pfam:Thioredoxin 166 272 7.4e-33 PFAM
low complexity region 427 445 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095820
AA Change: E319*
SMART Domains Protein: ENSMUSP00000093500
Gene: ENSMUSG00000020566
AA Change: E319*

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 417 3.4e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140751
SMART Domains Protein: ENSMUSP00000123415
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 133 4.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156727
AA Change: E249*
SMART Domains Protein: ENSMUSP00000117139
Gene: ENSMUSG00000020566
AA Change: E249*

DomainStartEndE-ValueType
Pfam:V-ATPase_C 1 347 2.5e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221129
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A,three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain C subunit isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,574,497 probably benign Het
9930021J03Rik T A 19: 29,719,545 E849D probably benign Het
Abca16 A G 7: 120,421,748 T5A probably benign Het
Abraxas1 T C 5: 100,806,237 D349G probably benign Het
Adcyap1r1 T A 6: 55,491,310 L405Q probably damaging Het
Aqp5 A T 15: 99,594,246 T125S probably benign Het
Asah1 A T 8: 41,347,069 N169K probably damaging Het
Atl3 A G 19: 7,533,968 N515D probably benign Het
Atl3 A C 19: 7,533,969 N520T probably benign Het
Bcl2a1b T A 9: 89,199,760 I134K probably damaging Het
Btbd10 C T 7: 113,329,922 R159H probably damaging Het
Chmp6 T C 11: 119,916,040 F7L probably damaging Het
Colq C A 14: 31,526,034 C409F probably damaging Het
Cpox T A 16: 58,670,927 V167E probably damaging Het
Cul3 T C 1: 80,276,424 Y545C probably benign Het
Dqx1 C T 6: 83,064,809 A544V probably benign Het
Dzip3 A G 16: 48,980,942 I73T probably benign Het
Epha3 T A 16: 63,568,455 Y810F probably damaging Het
Esp36 A T 17: 38,417,051 I113N unknown Het
Fbxw17 T A 13: 50,432,548 W429R probably damaging Het
Fcrls A T 3: 87,257,340 I293N possibly damaging Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8126 T A 14: 43,261,518 L148H probably benign Het
Gpr39 C A 1: 125,677,959 S208Y probably damaging Het
Heatr5a T C 12: 51,888,234 E1662G probably damaging Het
Hgfac T A 5: 35,044,429 L302Q possibly damaging Het
Itih1 G A 14: 30,931,309 H721Y possibly damaging Het
Kat8 A G 7: 127,924,903 I372V probably benign Het
Kcnk1 T A 8: 126,029,727 Y329* probably null Het
Kcns2 A T 15: 34,838,835 I115F probably damaging Het
Kif1a C T 1: 93,046,829 probably benign Het
Lcn2 T A 2: 32,387,596 D127V possibly damaging Het
Lrfn1 T C 7: 28,466,930 V583A possibly damaging Het
Map3k1 T C 13: 111,772,778 I55V probably benign Het
Mapk9 T C 11: 49,867,047 probably null Het
Mrpl18 A G 17: 12,913,781 S154P possibly damaging Het
Mst1 C A 9: 108,084,064 H524Q probably benign Het
Mtpap T C 18: 4,396,202 L498P probably damaging Het
Myl3 C T 9: 110,742,037 probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Mzf1 G T 7: 13,053,058 S28R probably damaging Het
Olfm1 T C 2: 28,222,616 S205P probably damaging Het
Olfr671 A T 7: 104,976,017 probably null Het
Prrc2a G A 17: 35,157,388 P809S probably damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rbm48 A T 5: 3,590,625 C251* probably null Het
Rxfp1 A T 3: 79,652,269 V415E probably damaging Het
Slc12a6 T A 2: 112,352,912 L748Q probably damaging Het
Slc19a3 T A 1: 83,022,369 Y309F probably damaging Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Slc38a4 G T 15: 97,009,014 S281* probably null Het
Syne1 A T 10: 5,346,859 S1201T probably damaging Het
Tex15 C A 8: 33,574,730 T1396K possibly damaging Het
Zswim8 G T 14: 20,714,573 probably null Het
Other mutations in Atp6v1c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Atp6v1c2 APN 12 17308293 missense probably damaging 1.00
IGL01520:Atp6v1c2 APN 12 17297753 missense probably damaging 1.00
IGL02121:Atp6v1c2 APN 12 17291440 missense possibly damaging 0.65
IGL02990:Atp6v1c2 APN 12 17294740 missense probably damaging 1.00
IGL03243:Atp6v1c2 APN 12 17289121 missense probably benign 0.07
R0077:Atp6v1c2 UTSW 12 17321612 missense probably damaging 1.00
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0358:Atp6v1c2 UTSW 12 17284960 splice site probably benign
R0373:Atp6v1c2 UTSW 12 17288168 missense probably damaging 1.00
R0536:Atp6v1c2 UTSW 12 17307508 splice site probably null
R1164:Atp6v1c2 UTSW 12 17308316 missense probably damaging 1.00
R1400:Atp6v1c2 UTSW 12 17289130 missense probably benign 0.13
R2133:Atp6v1c2 UTSW 12 17321611 missense probably benign 0.03
R4695:Atp6v1c2 UTSW 12 17301207 missense probably benign 0.02
R4825:Atp6v1c2 UTSW 12 17289060 missense probably benign 0.02
R5215:Atp6v1c2 UTSW 12 17291658 missense probably benign 0.08
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R6196:Atp6v1c2 UTSW 12 17301186 nonsense probably null
R7505:Atp6v1c2 UTSW 12 17297723 splice site probably null
R7559:Atp6v1c2 UTSW 12 17301214 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CTCCAGAAAGTCCATGAAGGTTAG -3'
(R):5'- GGATTCCAGAGCTTGCTTGC -3'

Sequencing Primer
(F):5'- TTAGGACAGCAGGATTCTAGGCTC -3'
(R):5'- CCCAGGCCATGAGAATTATTTGTG -3'
Posted On2019-05-13