Incidental Mutation 'R7059:Slc38a4'
ID548145
Institutional Source Beutler Lab
Gene Symbol Slc38a4
Ensembl Gene ENSMUSG00000022464
Gene Namesolute carrier family 38, member 4
Synonyms1700012A18Rik, Ata3, 1110012E16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R7059 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location96994820-97055956 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 97009014 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 281 (S281*)
Ref Sequence ENSEMBL: ENSMUSP00000155158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023101] [ENSMUST00000166223] [ENSMUST00000230086] [ENSMUST00000230907] [ENSMUST00000231039]
Predicted Effect probably null
Transcript: ENSMUST00000023101
AA Change: S281*
SMART Domains Protein: ENSMUSP00000023101
Gene: ENSMUSG00000022464
AA Change: S281*

DomainStartEndE-ValueType
Pfam:Aa_trans 73 263 4.9e-38 PFAM
Pfam:Aa_trans 302 535 2.1e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166223
AA Change: S281*
SMART Domains Protein: ENSMUSP00000127676
Gene: ENSMUSG00000022464
AA Change: S281*

DomainStartEndE-ValueType
Pfam:Aa_trans 73 262 2.5e-38 PFAM
Pfam:Aa_trans 303 535 2.5e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000230086
AA Change: S281*
Predicted Effect probably benign
Transcript: ENSMUST00000230907
Predicted Effect probably null
Transcript: ENSMUST00000231039
AA Change: S281*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC38A4 is found predominantly in liver and transports both cationic and neutral amino acids. The transport of cationic amino acids by SLC38A4 is Na(+) and pH independent, while the transport of neutral amino acids is Na(+) and pH dependent (Hatanaka et al., 2001 [PubMed 11342143]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,574,497 probably benign Het
9930021J03Rik T A 19: 29,719,545 E849D probably benign Het
Abca16 A G 7: 120,421,748 T5A probably benign Het
Abraxas1 T C 5: 100,806,237 D349G probably benign Het
Adcyap1r1 T A 6: 55,491,310 L405Q probably damaging Het
Aqp5 A T 15: 99,594,246 T125S probably benign Het
Asah1 A T 8: 41,347,069 N169K probably damaging Het
Atl3 A G 19: 7,533,968 N515D probably benign Het
Atl3 A C 19: 7,533,969 N520T probably benign Het
Atp6v1c2 C A 12: 17,289,004 E249* probably null Het
Bcl2a1b T A 9: 89,199,760 I134K probably damaging Het
Btbd10 C T 7: 113,329,922 R159H probably damaging Het
Chmp6 T C 11: 119,916,040 F7L probably damaging Het
Colq C A 14: 31,526,034 C409F probably damaging Het
Cpox T A 16: 58,670,927 V167E probably damaging Het
Cul3 T C 1: 80,276,424 Y545C probably benign Het
Dqx1 C T 6: 83,064,809 A544V probably benign Het
Dzip3 A G 16: 48,980,942 I73T probably benign Het
Epha3 T A 16: 63,568,455 Y810F probably damaging Het
Esp36 A T 17: 38,417,051 I113N unknown Het
Fbxw17 T A 13: 50,432,548 W429R probably damaging Het
Fcrls A T 3: 87,257,340 I293N possibly damaging Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8126 T A 14: 43,261,518 L148H probably benign Het
Gpr39 C A 1: 125,677,959 S208Y probably damaging Het
Heatr5a T C 12: 51,888,234 E1662G probably damaging Het
Hgfac T A 5: 35,044,429 L302Q possibly damaging Het
Itih1 G A 14: 30,931,309 H721Y possibly damaging Het
Kat8 A G 7: 127,924,903 I372V probably benign Het
Kcnk1 T A 8: 126,029,727 Y329* probably null Het
Kcns2 A T 15: 34,838,835 I115F probably damaging Het
Kif1a C T 1: 93,046,829 probably benign Het
Lcn2 T A 2: 32,387,596 D127V possibly damaging Het
Lrfn1 T C 7: 28,466,930 V583A possibly damaging Het
Map3k1 T C 13: 111,772,778 I55V probably benign Het
Mapk9 T C 11: 49,867,047 probably null Het
Mrpl18 A G 17: 12,913,781 S154P possibly damaging Het
Mst1 C A 9: 108,084,064 H524Q probably benign Het
Mtpap T C 18: 4,396,202 L498P probably damaging Het
Myl3 C T 9: 110,742,037 probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Mzf1 G T 7: 13,053,058 S28R probably damaging Het
Olfm1 T C 2: 28,222,616 S205P probably damaging Het
Olfr671 A T 7: 104,976,017 probably null Het
Prrc2a G A 17: 35,157,388 P809S probably damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rbm48 A T 5: 3,590,625 C251* probably null Het
Rxfp1 A T 3: 79,652,269 V415E probably damaging Het
Slc12a6 T A 2: 112,352,912 L748Q probably damaging Het
Slc19a3 T A 1: 83,022,369 Y309F probably damaging Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Syne1 A T 10: 5,346,859 S1201T probably damaging Het
Tex15 C A 8: 33,574,730 T1396K possibly damaging Het
Zswim8 G T 14: 20,714,573 probably null Het
Other mutations in Slc38a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Slc38a4 APN 15 97019809 missense probably benign 0.01
IGL00229:Slc38a4 APN 15 96999494 missense probably damaging 0.99
IGL00974:Slc38a4 APN 15 96999516 missense probably benign 0.05
IGL01951:Slc38a4 APN 15 97019763 missense probably benign 0.07
R0012:Slc38a4 UTSW 15 96999629 missense probably damaging 1.00
R0012:Slc38a4 UTSW 15 96999629 missense probably damaging 1.00
R0165:Slc38a4 UTSW 15 97008949 missense probably benign 0.00
R0304:Slc38a4 UTSW 15 97008454 missense probably damaging 1.00
R0543:Slc38a4 UTSW 15 97016839 missense possibly damaging 0.52
R0973:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R0973:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R0974:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R1340:Slc38a4 UTSW 15 97010272 splice site probably benign
R1973:Slc38a4 UTSW 15 96999597 missense probably benign 0.36
R2058:Slc38a4 UTSW 15 97008725 missense probably benign 0.22
R2083:Slc38a4 UTSW 15 97008993 missense probably benign 0.00
R2108:Slc38a4 UTSW 15 97008997 missense probably benign
R3908:Slc38a4 UTSW 15 97012994 critical splice acceptor site probably null
R4037:Slc38a4 UTSW 15 96997042 missense probably benign 0.03
R4259:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4260:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4261:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4370:Slc38a4 UTSW 15 97009084 missense possibly damaging 0.48
R4435:Slc38a4 UTSW 15 97009018 missense probably benign
R5289:Slc38a4 UTSW 15 97010348 missense possibly damaging 0.72
R5638:Slc38a4 UTSW 15 97012990 missense probably damaging 0.99
R5893:Slc38a4 UTSW 15 96999551 missense probably benign 0.23
R7223:Slc38a4 UTSW 15 97010345 missense probably damaging 1.00
R7267:Slc38a4 UTSW 15 97005900 missense probably benign 0.01
R7768:Slc38a4 UTSW 15 97008664 missense probably damaging 1.00
R7903:Slc38a4 UTSW 15 97008928 missense probably benign 0.03
R7986:Slc38a4 UTSW 15 97008928 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCACAGTACTCAGTGCCTTAGG -3'
(R):5'- AGATTTTAATCCCATCGCTTGC -3'

Sequencing Primer
(F):5'- TAGGGGCCTGTCACTTACC -3'
(R):5'- CTCTGGATCACAACAACG -3'
Posted On2019-05-13