Incidental Mutation 'R7060:Mxd1'
ID548179
Institutional Source Beutler Lab
Gene Symbol Mxd1
Ensembl Gene ENSMUSG00000001156
Gene NameMAX dimerization protein 1
SynonymsMad1, Mad
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R7060 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location86647042-86669161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86653159 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 26 (L26M)
Ref Sequence ENSEMBL: ENSMUSP00000145081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001184] [ENSMUST00000203946] [ENSMUST00000204437]
Predicted Effect probably damaging
Transcript: ENSMUST00000001184
AA Change: L81M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001184
Gene: ENSMUSG00000001156
AA Change: L81M

DomainStartEndE-ValueType
PDB:1PD7|B 5 28 6e-7 PDB
HLH 61 113 1.14e-9 SMART
low complexity region 143 175 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203946
AA Change: L26M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145081
Gene: ENSMUSG00000001156
AA Change: L26M

DomainStartEndE-ValueType
HLH 6 58 4.8e-12 SMART
low complexity region 88 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204437
SMART Domains Protein: ENSMUSP00000145396
Gene: ENSMUSG00000001156

DomainStartEndE-ValueType
PDB:1PD7|B 5 28 3e-8 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MYC/MAX/MAD network of basic helix-loop-helix leucine zipper transcription factors. The MYC/MAX/MAD transcription factors mediate cellular proliferation, differentiation and apoptosis. The encoded protein antagonizes MYC-mediated transcriptional activation of target genes by competing for the binding partner MAX and recruiting repressor complexes containing histone deacetylases. Mutations in this gene may play a role in acute leukemia, and the encoded protein is a potential tumor suppressor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered myelopoiesis, increased proliferative potential of bone marrow granulocytic precursors, increased sensitivity of myeloid cells to apoptosis-inducing stimuli, and inhibited cell cycle withdrawal during a late stage of granulocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A C 8: 129,219,132 I404R probably benign Het
5730559C18Rik T C 1: 136,220,197 K339R possibly damaging Het
Abcg4 T A 9: 44,275,128 T535S probably benign Het
Adamts19 A T 18: 58,837,640 R99* probably null Het
Alg6 C T 4: 99,761,961 L473F possibly damaging Het
Ankar A T 1: 72,656,113 N893K probably benign Het
Ankrd54 G A 15: 79,055,539 A183V possibly damaging Het
Anpep G T 7: 79,841,794 T153K probably benign Het
Arap1 A G 7: 101,409,357 probably null Het
Aspg A T 12: 112,122,953 T392S probably benign Het
B230307C23Rik A C 16: 98,010,131 R68S probably benign Het
Bdp1 G C 13: 100,059,494 N1253K probably damaging Het
Ccrl2 G A 9: 111,055,614 S272F probably damaging Het
Cdon T C 9: 35,486,909 L974P probably damaging Het
Celsr1 C A 15: 86,032,655 E372D probably benign Het
Cers1 A T 8: 70,315,905 M16L possibly damaging Het
Col2a1 G T 15: 97,976,141 Q1387K unknown Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dppa2 T A 16: 48,315,713 S143T probably benign Het
Dpy19l1 A T 9: 24,423,123 M583K possibly damaging Het
Eno3 A T 11: 70,661,419 D299V possibly damaging Het
Epha8 C T 4: 136,931,158 V969M probably damaging Het
Fcgbp A T 7: 28,091,933 H873L probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fntb A C 12: 76,887,875 N173T possibly damaging Het
Gins2 T A 8: 120,582,141 M125L probably benign Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Herpud1 C A 8: 94,390,763 H116N probably benign Het
Hoga1 C A 19: 42,060,246 Y134* probably null Het
Il10ra A G 9: 45,256,224 I343T probably benign Het
Inpp5j C T 11: 3,500,133 probably null Het
Itpkb T C 1: 180,333,130 S274P probably damaging Het
Kalrn C T 16: 34,357,048 C249Y probably damaging Het
Klhl35 G C 7: 99,468,458 A70P possibly damaging Het
Lhx1 A G 11: 84,520,282 probably null Het
Lmbrd1 T C 1: 24,692,966 V88A probably benign Het
Macc1 T G 12: 119,447,455 L653V probably damaging Het
Madd T C 2: 91,177,107 D220G probably damaging Het
Mllt10 T A 2: 18,159,560 H300Q possibly damaging Het
Mlxipl G A 5: 135,132,315 A363T possibly damaging Het
Mus81 G T 19: 5,487,793 D78E probably benign Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Nos1ap A G 1: 170,338,125 S190P possibly damaging Het
Nwd1 A C 8: 72,666,694 D195A probably damaging Het
Olfr103 G T 17: 37,336,461 T257N probably benign Het
Olfr1058 T A 2: 86,386,225 R64S possibly damaging Het
Olfr424 A T 1: 174,136,810 D22V probably benign Het
Olfr892-ps1 G A 9: 38,190,096 V124I probably damaging Het
Otof T C 5: 30,388,356 D500G possibly damaging Het
Pcgf5 T A 19: 36,442,939 Y190* probably null Het
Pdcd11 C T 19: 47,110,979 T839I probably benign Het
Ppard G C 17: 28,298,912 S318T probably benign Het
Ppfia2 A G 10: 106,762,109 K178E probably damaging Het
Ppm1n G T 7: 19,279,262 R255S probably damaging Het
Ppp1r21 A G 17: 88,580,544 Y693C probably damaging Het
Ppp2r5d A T 17: 46,687,353 V169E possibly damaging Het
Prc1 A T 7: 80,304,373 T53S probably benign Het
Pwp2 A C 10: 78,173,250 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Ring1 A G 17: 34,023,390 C48R probably damaging Het
Rpap1 T C 2: 119,773,562 D496G probably damaging Het
Rspo4 C A 2: 151,873,078 Q212K unknown Het
Samd9l T A 6: 3,372,716 D1515V probably damaging Het
Serinc3 T C 2: 163,636,959 T83A probably benign Het
Setd5 A C 6: 113,117,382 D420A probably damaging Het
Sidt2 T C 9: 45,953,246 T62A possibly damaging Het
Smarcal1 T C 1: 72,612,942 V621A probably damaging Het
Srcin1 A G 11: 97,573,885 L12P probably damaging Het
Stx18 G A 5: 38,121,255 D165N possibly damaging Het
Sumf2 A G 5: 129,854,500 K139E possibly damaging Het
Tdo2 A T 3: 81,969,559 I102N probably damaging Het
Tdp1 T A 12: 99,911,688 S410T probably benign Het
Tmem94 A T 11: 115,792,938 I726F probably damaging Het
Ttc21a A G 9: 119,966,676 E1192G probably damaging Het
Ttc8 T C 12: 98,943,467 I52T probably benign Het
Vmn2r99 A T 17: 19,394,564 R849* probably null Het
Wwc1 T C 11: 35,915,176 K77E possibly damaging Het
Xirp2 A T 2: 67,515,608 E2731V probably damaging Het
Zfp423 G A 8: 87,782,879 T258I probably damaging Het
Other mutations in Mxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
LCD18:Mxd1 UTSW 6 86667406 intron probably benign
R1385:Mxd1 UTSW 6 86651567 missense probably damaging 0.96
R1510:Mxd1 UTSW 6 86653155 missense possibly damaging 0.96
R1595:Mxd1 UTSW 6 86651471 missense possibly damaging 0.93
R2126:Mxd1 UTSW 6 86651440 critical splice donor site probably null
R3905:Mxd1 UTSW 6 86650960 missense probably benign 0.44
R3907:Mxd1 UTSW 6 86650960 missense probably benign 0.44
R3909:Mxd1 UTSW 6 86650960 missense probably benign 0.44
R6048:Mxd1 UTSW 6 86650984 missense probably damaging 1.00
R7351:Mxd1 UTSW 6 86651466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCATCCTGGAGACACATTTC -3'
(R):5'- ACCTATGCCCAGAATTACAAATGG -3'

Sequencing Primer
(F):5'- TGGAGACACATTTCCATCTATCTG -3'
(R):5'- TGGAATCAACCTGGAAGCC -3'
Posted On2019-05-13