Incidental Mutation 'R7060:Ccrl2'
ID548199
Institutional Source Beutler Lab
Gene Symbol Ccrl2
Ensembl Gene ENSMUSG00000043953
Gene Namechemokine (C-C motif) receptor-like 2
SynonymsCCR11, Cmkbr1l2, L-CCR
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7060 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location111054486-111057519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111055614 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 272 (S272F)
Ref Sequence ENSEMBL: ENSMUSP00000143116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111888] [ENSMUST00000195968] [ENSMUST00000199839]
Predicted Effect probably damaging
Transcript: ENSMUST00000111888
AA Change: S272F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107519
Gene: ENSMUSG00000043953
AA Change: S272F

DomainStartEndE-ValueType
Pfam:7tm_1 54 304 6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195968
SMART Domains Protein: ENSMUSP00000143105
Gene: ENSMUSG00000043953

DomainStartEndE-ValueType
Pfam:7tm_1 54 130 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199839
AA Change: S272F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143116
Gene: ENSMUSG00000043953
AA Change: S272F

DomainStartEndE-ValueType
Pfam:7tm_1 54 304 4.2e-31 PFAM
Meta Mutation Damage Score 0.4228 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chemokine receptor like protein, which is predicted to be a seven transmembrane protein and most closely related to CCR1. Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. This gene is expressed at high levels in primary neutrophils and primary monocytes, and is further upregulated on neutrophil activation and during monocyte to macrophage differentiation. The function of this gene is unknown. This gene is mapped to the region where the chemokine receptor gene cluster is located. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A C 8: 129,219,132 I404R probably benign Het
5730559C18Rik T C 1: 136,220,197 K339R possibly damaging Het
Abcg4 T A 9: 44,275,128 T535S probably benign Het
Adamts19 A T 18: 58,837,640 R99* probably null Het
Alg6 C T 4: 99,761,961 L473F possibly damaging Het
Ankar A T 1: 72,656,113 N893K probably benign Het
Ankrd54 G A 15: 79,055,539 A183V possibly damaging Het
Anpep G T 7: 79,841,794 T153K probably benign Het
Arap1 A G 7: 101,409,357 probably null Het
Aspg A T 12: 112,122,953 T392S probably benign Het
B230307C23Rik A C 16: 98,010,131 R68S probably benign Het
Bdp1 G C 13: 100,059,494 N1253K probably damaging Het
Cdon T C 9: 35,486,909 L974P probably damaging Het
Celsr1 C A 15: 86,032,655 E372D probably benign Het
Cers1 A T 8: 70,315,905 M16L possibly damaging Het
Col2a1 G T 15: 97,976,141 Q1387K unknown Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dppa2 T A 16: 48,315,713 S143T probably benign Het
Dpy19l1 A T 9: 24,423,123 M583K possibly damaging Het
Eno3 A T 11: 70,661,419 D299V possibly damaging Het
Epha8 C T 4: 136,931,158 V969M probably damaging Het
Fcgbp A T 7: 28,091,933 H873L probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fntb A C 12: 76,887,875 N173T possibly damaging Het
Gins2 T A 8: 120,582,141 M125L probably benign Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Herpud1 C A 8: 94,390,763 H116N probably benign Het
Hoga1 C A 19: 42,060,246 Y134* probably null Het
Il10ra A G 9: 45,256,224 I343T probably benign Het
Inpp5j C T 11: 3,500,133 probably null Het
Itpkb T C 1: 180,333,130 S274P probably damaging Het
Kalrn C T 16: 34,357,048 C249Y probably damaging Het
Klhl35 G C 7: 99,468,458 A70P possibly damaging Het
Lhx1 A G 11: 84,520,282 probably null Het
Lmbrd1 T C 1: 24,692,966 V88A probably benign Het
Macc1 T G 12: 119,447,455 L653V probably damaging Het
Madd T C 2: 91,177,107 D220G probably damaging Het
Mllt10 T A 2: 18,159,560 H300Q possibly damaging Het
Mlxipl G A 5: 135,132,315 A363T possibly damaging Het
Mus81 G T 19: 5,487,793 D78E probably benign Het
Mxd1 A T 6: 86,653,159 L26M probably damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Nos1ap A G 1: 170,338,125 S190P possibly damaging Het
Nwd1 A C 8: 72,666,694 D195A probably damaging Het
Olfr103 G T 17: 37,336,461 T257N probably benign Het
Olfr1058 T A 2: 86,386,225 R64S possibly damaging Het
Olfr424 A T 1: 174,136,810 D22V probably benign Het
Olfr892-ps1 G A 9: 38,190,096 V124I probably damaging Het
Otof T C 5: 30,388,356 D500G possibly damaging Het
Pcgf5 T A 19: 36,442,939 Y190* probably null Het
Pdcd11 C T 19: 47,110,979 T839I probably benign Het
Ppard G C 17: 28,298,912 S318T probably benign Het
Ppfia2 A G 10: 106,762,109 K178E probably damaging Het
Ppm1n G T 7: 19,279,262 R255S probably damaging Het
Ppp1r21 A G 17: 88,580,544 Y693C probably damaging Het
Ppp2r5d A T 17: 46,687,353 V169E possibly damaging Het
Prc1 A T 7: 80,304,373 T53S probably benign Het
Pwp2 A C 10: 78,173,250 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Ring1 A G 17: 34,023,390 C48R probably damaging Het
Rpap1 T C 2: 119,773,562 D496G probably damaging Het
Rspo4 C A 2: 151,873,078 Q212K unknown Het
Samd9l T A 6: 3,372,716 D1515V probably damaging Het
Serinc3 T C 2: 163,636,959 T83A probably benign Het
Setd5 A C 6: 113,117,382 D420A probably damaging Het
Sidt2 T C 9: 45,953,246 T62A possibly damaging Het
Smarcal1 T C 1: 72,612,942 V621A probably damaging Het
Srcin1 A G 11: 97,573,885 L12P probably damaging Het
Stx18 G A 5: 38,121,255 D165N possibly damaging Het
Sumf2 A G 5: 129,854,500 K139E possibly damaging Het
Tdo2 A T 3: 81,969,559 I102N probably damaging Het
Tdp1 T A 12: 99,911,688 S410T probably benign Het
Tmem94 A T 11: 115,792,938 I726F probably damaging Het
Ttc21a A G 9: 119,966,676 E1192G probably damaging Het
Ttc8 T C 12: 98,943,467 I52T probably benign Het
Vmn2r99 A T 17: 19,394,564 R849* probably null Het
Wwc1 T C 11: 35,915,176 K77E possibly damaging Het
Xirp2 A T 2: 67,515,608 E2731V probably damaging Het
Zfp423 G A 8: 87,782,879 T258I probably damaging Het
Other mutations in Ccrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02382:Ccrl2 APN 9 111055879 missense probably benign 0.22
IGL02492:Ccrl2 APN 9 111055803 missense probably benign 0.01
octomom UTSW 9 111055987 splice site probably null
IGL03134:Ccrl2 UTSW 9 111055657 missense probably damaging 1.00
R0321:Ccrl2 UTSW 9 111056211 missense probably damaging 0.97
R0924:Ccrl2 UTSW 9 111055968 missense probably benign 0.39
R0967:Ccrl2 UTSW 9 111055686 missense probably benign 0.02
R2033:Ccrl2 UTSW 9 111055870 missense possibly damaging 0.95
R3720:Ccrl2 UTSW 9 111056364 missense probably benign 0.01
R3721:Ccrl2 UTSW 9 111056364 missense probably benign 0.01
R4244:Ccrl2 UTSW 9 111055354 missense probably benign 0.33
R5634:Ccrl2 UTSW 9 111055987 splice site probably null
R7027:Ccrl2 UTSW 9 111055885 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCCTCCACTACTTTGATAGGGG -3'
(R):5'- CGCTCTGGAAGTACGTTCTGAC -3'

Sequencing Primer
(F):5'- GATATCATTGCACCGTGGGAAC -3'
(R):5'- CGTTCTGACGTCAAAAATGATCATC -3'
Posted On2019-05-13