Incidental Mutation 'R7060:Ppfia2'
ID548202
Institutional Source Beutler Lab
Gene Symbol Ppfia2
Ensembl Gene ENSMUSG00000053825
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
SynonymsLiprin-alpha2, E130120L08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7060 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location106470339-106935952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106762109 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 178 (K178E)
Ref Sequence ENSEMBL: ENSMUSP00000029404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029404] [ENSMUST00000217854]
Predicted Effect probably damaging
Transcript: ENSMUST00000029404
AA Change: K178E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029404
Gene: ENSMUSG00000053825
AA Change: K178E

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
coiled coil region 32 80 N/A INTRINSIC
coiled coil region 102 150 N/A INTRINSIC
coiled coil region 189 234 N/A INTRINSIC
coiled coil region 267 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
coiled coil region 643 691 N/A INTRINSIC
low complexity region 702 725 N/A INTRINSIC
SAM 895 964 6.27e-10 SMART
low complexity region 965 977 N/A INTRINSIC
SAM 1017 1084 1.69e-6 SMART
SAM 1105 1177 6.62e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217854
AA Change: K178E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein has been shown to bind the calcium/calmodulin-dependent serine protein kinase (MAGUK family) protein (also known as CASK) and proposed to regulate higher-order brain functions in mammals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A C 8: 129,219,132 I404R probably benign Het
5730559C18Rik T C 1: 136,220,197 K339R possibly damaging Het
Abcg4 T A 9: 44,275,128 T535S probably benign Het
Adamts19 A T 18: 58,837,640 R99* probably null Het
Alg6 C T 4: 99,761,961 L473F possibly damaging Het
Ankar A T 1: 72,656,113 N893K probably benign Het
Ankrd54 G A 15: 79,055,539 A183V possibly damaging Het
Anpep G T 7: 79,841,794 T153K probably benign Het
Arap1 A G 7: 101,409,357 probably null Het
Aspg A T 12: 112,122,953 T392S probably benign Het
B230307C23Rik A C 16: 98,010,131 R68S probably benign Het
Bdp1 G C 13: 100,059,494 N1253K probably damaging Het
Ccrl2 G A 9: 111,055,614 S272F probably damaging Het
Cdon T C 9: 35,486,909 L974P probably damaging Het
Celsr1 C A 15: 86,032,655 E372D probably benign Het
Cers1 A T 8: 70,315,905 M16L possibly damaging Het
Col2a1 G T 15: 97,976,141 Q1387K unknown Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dppa2 T A 16: 48,315,713 S143T probably benign Het
Dpy19l1 A T 9: 24,423,123 M583K possibly damaging Het
Eno3 A T 11: 70,661,419 D299V possibly damaging Het
Epha8 C T 4: 136,931,158 V969M probably damaging Het
Fcgbp A T 7: 28,091,933 H873L probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fntb A C 12: 76,887,875 N173T possibly damaging Het
Gins2 T A 8: 120,582,141 M125L probably benign Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Herpud1 C A 8: 94,390,763 H116N probably benign Het
Hoga1 C A 19: 42,060,246 Y134* probably null Het
Il10ra A G 9: 45,256,224 I343T probably benign Het
Inpp5j C T 11: 3,500,133 probably null Het
Itpkb T C 1: 180,333,130 S274P probably damaging Het
Kalrn C T 16: 34,357,048 C249Y probably damaging Het
Klhl35 G C 7: 99,468,458 A70P possibly damaging Het
Lhx1 A G 11: 84,520,282 probably null Het
Lmbrd1 T C 1: 24,692,966 V88A probably benign Het
Macc1 T G 12: 119,447,455 L653V probably damaging Het
Madd T C 2: 91,177,107 D220G probably damaging Het
Mllt10 T A 2: 18,159,560 H300Q possibly damaging Het
Mlxipl G A 5: 135,132,315 A363T possibly damaging Het
Mus81 G T 19: 5,487,793 D78E probably benign Het
Mxd1 A T 6: 86,653,159 L26M probably damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Nos1ap A G 1: 170,338,125 S190P possibly damaging Het
Nwd1 A C 8: 72,666,694 D195A probably damaging Het
Olfr103 G T 17: 37,336,461 T257N probably benign Het
Olfr1058 T A 2: 86,386,225 R64S possibly damaging Het
Olfr424 A T 1: 174,136,810 D22V probably benign Het
Olfr892-ps1 G A 9: 38,190,096 V124I probably damaging Het
Otof T C 5: 30,388,356 D500G possibly damaging Het
Pcgf5 T A 19: 36,442,939 Y190* probably null Het
Pdcd11 C T 19: 47,110,979 T839I probably benign Het
Ppard G C 17: 28,298,912 S318T probably benign Het
Ppm1n G T 7: 19,279,262 R255S probably damaging Het
Ppp1r21 A G 17: 88,580,544 Y693C probably damaging Het
Ppp2r5d A T 17: 46,687,353 V169E possibly damaging Het
Prc1 A T 7: 80,304,373 T53S probably benign Het
Pwp2 A C 10: 78,173,250 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Ring1 A G 17: 34,023,390 C48R probably damaging Het
Rpap1 T C 2: 119,773,562 D496G probably damaging Het
Rspo4 C A 2: 151,873,078 Q212K unknown Het
Samd9l T A 6: 3,372,716 D1515V probably damaging Het
Serinc3 T C 2: 163,636,959 T83A probably benign Het
Setd5 A C 6: 113,117,382 D420A probably damaging Het
Sidt2 T C 9: 45,953,246 T62A possibly damaging Het
Smarcal1 T C 1: 72,612,942 V621A probably damaging Het
Srcin1 A G 11: 97,573,885 L12P probably damaging Het
Stx18 G A 5: 38,121,255 D165N possibly damaging Het
Sumf2 A G 5: 129,854,500 K139E possibly damaging Het
Tdo2 A T 3: 81,969,559 I102N probably damaging Het
Tdp1 T A 12: 99,911,688 S410T probably benign Het
Tmem94 A T 11: 115,792,938 I726F probably damaging Het
Ttc21a A G 9: 119,966,676 E1192G probably damaging Het
Ttc8 T C 12: 98,943,467 I52T probably benign Het
Vmn2r99 A T 17: 19,394,564 R849* probably null Het
Wwc1 T C 11: 35,915,176 K77E possibly damaging Het
Xirp2 A T 2: 67,515,608 E2731V probably damaging Het
Zfp423 G A 8: 87,782,879 T258I probably damaging Het
Other mutations in Ppfia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Ppfia2 APN 10 106819492 missense probably benign 0.25
IGL01296:Ppfia2 APN 10 106858207 missense probably damaging 0.98
IGL01385:Ppfia2 APN 10 106913699 missense probably damaging 1.00
IGL01592:Ppfia2 APN 10 106836048 splice site probably benign
IGL01899:Ppfia2 APN 10 106915751 critical splice donor site probably null
IGL02063:Ppfia2 APN 10 106904845 missense probably null 0.83
IGL02143:Ppfia2 APN 10 106857499 missense probably damaging 1.00
IGL02170:Ppfia2 APN 10 106800785 missense probably benign
IGL02565:Ppfia2 APN 10 106863386 critical splice donor site probably null
IGL02573:Ppfia2 APN 10 106828928 missense probably damaging 1.00
IGL02819:Ppfia2 APN 10 106906394 missense probably damaging 1.00
IGL02974:Ppfia2 APN 10 106800776 missense probably benign 0.08
IGL03165:Ppfia2 APN 10 106767487 missense probably damaging 1.00
IGL03255:Ppfia2 APN 10 106896507 missense possibly damaging 0.76
PIT4458001:Ppfia2 UTSW 10 106927847 missense probably benign 0.24
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0323:Ppfia2 UTSW 10 106896420 missense possibly damaging 0.84
R0391:Ppfia2 UTSW 10 106830714 splice site probably benign
R0667:Ppfia2 UTSW 10 106913694 missense probably damaging 0.97
R0782:Ppfia2 UTSW 10 106927731 missense probably benign 0.32
R0905:Ppfia2 UTSW 10 106819511 missense probably benign 0.43
R1401:Ppfia2 UTSW 10 106830657 missense possibly damaging 0.94
R1672:Ppfia2 UTSW 10 106830568 missense possibly damaging 0.53
R1723:Ppfia2 UTSW 10 106915672 splice site probably null
R1780:Ppfia2 UTSW 10 106896507 missense possibly damaging 0.76
R1847:Ppfia2 UTSW 10 106927710 missense probably benign 0.16
R2015:Ppfia2 UTSW 10 106474677 missense probably benign 0.01
R2051:Ppfia2 UTSW 10 106837299 missense probably damaging 0.98
R2061:Ppfia2 UTSW 10 106837329 missense possibly damaging 0.94
R2115:Ppfia2 UTSW 10 106762111 missense probably damaging 1.00
R2310:Ppfia2 UTSW 10 106854980 missense probably damaging 0.99
R2394:Ppfia2 UTSW 10 106819490 missense probably damaging 0.99
R2656:Ppfia2 UTSW 10 106865407 splice site probably null
R3113:Ppfia2 UTSW 10 106906395 nonsense probably null
R3968:Ppfia2 UTSW 10 106906521 missense probably damaging 0.99
R3977:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3978:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3979:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R4567:Ppfia2 UTSW 10 106865406 splice site probably null
R4632:Ppfia2 UTSW 10 106836044 splice site probably null
R4718:Ppfia2 UTSW 10 106858285 missense probably damaging 1.00
R4758:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4770:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4810:Ppfia2 UTSW 10 106915690 missense probably benign 0.01
R4841:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4842:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4914:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4916:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4917:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R5014:Ppfia2 UTSW 10 106865363 nonsense probably null
R5029:Ppfia2 UTSW 10 106857443 missense probably benign 0.04
R5127:Ppfia2 UTSW 10 106835760 missense probably damaging 0.99
R5357:Ppfia2 UTSW 10 106904847 critical splice donor site probably null
R5420:Ppfia2 UTSW 10 106835701 missense possibly damaging 0.88
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6135:Ppfia2 UTSW 10 106857569 missense probably damaging 1.00
R6237:Ppfia2 UTSW 10 106913594 missense probably damaging 1.00
R6433:Ppfia2 UTSW 10 106913698 missense possibly damaging 0.94
R6457:Ppfia2 UTSW 10 106893500 missense probably damaging 1.00
R6542:Ppfia2 UTSW 10 106835725 missense probably damaging 0.99
R6674:Ppfia2 UTSW 10 106927772 missense probably benign 0.23
R6746:Ppfia2 UTSW 10 106906458 nonsense probably null
R6992:Ppfia2 UTSW 10 106474854 missense possibly damaging 0.88
R7346:Ppfia2 UTSW 10 106857495 missense possibly damaging 0.79
R7453:Ppfia2 UTSW 10 106927830 missense possibly damaging 0.82
R7555:Ppfia2 UTSW 10 106927826 missense probably benign 0.00
X0021:Ppfia2 UTSW 10 106474677 missense probably benign 0.06
X0022:Ppfia2 UTSW 10 106893434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCAAGTGCCTGCTTAAAC -3'
(R):5'- GGCGTCTAAGAATGCAGTAATG -3'

Sequencing Primer
(F):5'- GCAAGTGCCTGCTTAAACTAACTG -3'
(R):5'- AATTAAGGCGTTTCCCGC -3'
Posted On2019-05-13