Incidental Mutation 'R7060:Vmn2r99'
ID 548222
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Name vomeronasal 2, receptor 99
Synonyms EG665376
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R7060 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19361949-19401098 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 19394564 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 849 (R849*)
Ref Sequence ENSEMBL: ENSMUSP00000135236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
AlphaFold H3BK37
Predicted Effect probably null
Transcript: ENSMUST00000176107
AA Change: R849*
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: R849*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231989
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (78/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A C 8: 129,219,132 I404R probably benign Het
5730559C18Rik T C 1: 136,220,197 K339R possibly damaging Het
Abcg4 T A 9: 44,275,128 T535S probably benign Het
Adamts19 A T 18: 58,837,640 R99* probably null Het
Alg6 C T 4: 99,761,961 L473F possibly damaging Het
Ankar A T 1: 72,656,113 N893K probably benign Het
Ankrd54 G A 15: 79,055,539 A183V possibly damaging Het
Anpep G T 7: 79,841,794 T153K probably benign Het
Arap1 A G 7: 101,409,357 probably null Het
Aspg A T 12: 112,122,953 T392S probably benign Het
B230307C23Rik A C 16: 98,010,131 R68S probably benign Het
Bdp1 G C 13: 100,059,494 N1253K probably damaging Het
Ccrl2 G A 9: 111,055,614 S272F probably damaging Het
Cdon T C 9: 35,486,909 L974P probably damaging Het
Celsr1 C A 15: 86,032,655 E372D probably benign Het
Cers1 A T 8: 70,315,905 M16L possibly damaging Het
Col2a1 G T 15: 97,976,141 Q1387K unknown Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dppa2 T A 16: 48,315,713 S143T probably benign Het
Dpy19l1 A T 9: 24,423,123 M583K possibly damaging Het
Eno3 A T 11: 70,661,419 D299V possibly damaging Het
Epha8 C T 4: 136,931,158 V969M probably damaging Het
Fcgbp A T 7: 28,091,933 H873L probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fntb A C 12: 76,887,875 N173T possibly damaging Het
Gins2 T A 8: 120,582,141 M125L probably benign Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Herpud1 C A 8: 94,390,763 H116N probably benign Het
Hoga1 C A 19: 42,060,246 Y134* probably null Het
Il10ra A G 9: 45,256,224 I343T probably benign Het
Inpp5j C T 11: 3,500,133 probably null Het
Itpkb T C 1: 180,333,130 S274P probably damaging Het
Kalrn C T 16: 34,357,048 C249Y probably damaging Het
Klhl35 G C 7: 99,468,458 A70P possibly damaging Het
Lhx1 A G 11: 84,520,282 probably null Het
Lmbrd1 T C 1: 24,692,966 V88A probably benign Het
Macc1 T G 12: 119,447,455 L653V probably damaging Het
Madd T C 2: 91,177,107 D220G probably damaging Het
Mllt10 T A 2: 18,159,560 H300Q possibly damaging Het
Mlxipl G A 5: 135,132,315 A363T possibly damaging Het
Mus81 G T 19: 5,487,793 D78E probably benign Het
Mxd1 A T 6: 86,653,159 L26M probably damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Nos1ap A G 1: 170,338,125 S190P possibly damaging Het
Nwd1 A C 8: 72,666,694 D195A probably damaging Het
Olfr103 G T 17: 37,336,461 T257N probably benign Het
Olfr1058 T A 2: 86,386,225 R64S possibly damaging Het
Olfr424 A T 1: 174,136,810 D22V probably benign Het
Olfr892-ps1 G A 9: 38,190,096 V124I probably damaging Het
Otof T C 5: 30,388,356 D500G possibly damaging Het
Pcgf5 T A 19: 36,442,939 Y190* probably null Het
Pdcd11 C T 19: 47,110,979 T839I probably benign Het
Ppard G C 17: 28,298,912 S318T probably benign Het
Ppfia2 A G 10: 106,762,109 K178E probably damaging Het
Ppm1n G T 7: 19,279,262 R255S probably damaging Het
Ppp1r21 A G 17: 88,580,544 Y693C probably damaging Het
Ppp2r5d A T 17: 46,687,353 V169E possibly damaging Het
Prc1 A T 7: 80,304,373 T53S probably benign Het
Pwp2 A C 10: 78,173,250 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Ring1 A G 17: 34,023,390 C48R probably damaging Het
Rpap1 T C 2: 119,773,562 D496G probably damaging Het
Rspo4 C A 2: 151,873,078 Q212K unknown Het
Samd9l T A 6: 3,372,716 D1515V probably damaging Het
Serinc3 T C 2: 163,636,959 T83A probably benign Het
Setd5 A C 6: 113,117,382 D420A probably damaging Het
Sidt2 T C 9: 45,953,246 T62A possibly damaging Het
Smarcal1 T C 1: 72,612,942 V621A probably damaging Het
Srcin1 A G 11: 97,573,885 L12P probably damaging Het
Stx18 G A 5: 38,121,255 D165N possibly damaging Het
Sumf2 A G 5: 129,854,500 K139E possibly damaging Het
Tdo2 A T 3: 81,969,559 I102N probably damaging Het
Tdp1 T A 12: 99,911,688 S410T probably benign Het
Tmem94 A T 11: 115,792,938 I726F probably damaging Het
Ttc21a A G 9: 119,966,676 E1192G probably damaging Het
Ttc8 T C 12: 98,943,467 I52T probably benign Het
Wwc1 T C 11: 35,915,176 K77E possibly damaging Het
Xirp2 A T 2: 67,515,608 E2731V probably damaging Het
Zfp423 G A 8: 87,782,879 T258I probably damaging Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19378854 missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19394256 missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19382623 missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19393658 splice site probably benign
IGL01769:Vmn2r99 APN 17 19380115 missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19380232 missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19378690 nonsense probably null
IGL03132:Vmn2r99 APN 17 19378223 nonsense probably null
FR4548:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19394343 missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19394573 missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19379043 missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19362259 missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19380060 missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19362252 missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19377945 missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19362153 missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19378815 missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19377991 missense probably damaging 1.00
R2474:Vmn2r99 UTSW 17 19378629 missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19378708 missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19394373 missense possibly damaging 0.92
R3947:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R3949:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19378570 missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19379260 missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19393662 missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19362135 start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19378606 missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19379339 missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19379269 missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19394146 nonsense probably null
R6021:Vmn2r99 UTSW 17 19377948 missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19378980 missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19382605 missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19380031 missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19380034 missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19380195 missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19378110 missense probably benign 0.03
R7090:Vmn2r99 UTSW 17 19393710 missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19379311 missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19379145 missense probably benign 0.01
R7789:Vmn2r99 UTSW 17 19393817 missense possibly damaging 0.91
R8039:Vmn2r99 UTSW 17 19380040 missense probably benign 0.00
R8493:Vmn2r99 UTSW 17 19393758 missense probably benign 0.15
R8511:Vmn2r99 UTSW 17 19394181 missense probably damaging 1.00
R8715:Vmn2r99 UTSW 17 19393660 critical splice acceptor site probably benign
R9462:Vmn2r99 UTSW 17 19378126 nonsense probably null
Z1088:Vmn2r99 UTSW 17 19379301 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GTTCTTCTGTGTCTGGGTCACC -3'
(R):5'- TCCCATGTTGTTCATTTTCAAATATG -3'

Sequencing Primer
(F):5'- GTGTCTGGGTCACCTTTCTTC -3'
(R):5'- GCATCTATTGAGAAAGGAAGGAAAC -3'
Posted On 2019-05-13