Incidental Mutation 'R7060:Ring1'
ID 548224
Institutional Source Beutler Lab
Gene Symbol Ring1
Ensembl Gene ENSMUSG00000024325
Gene Name ring finger protein 1
Synonyms Ring1A
MMRRC Submission 045157-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.723) question?
Stock # R7060 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34239766-34243654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34242364 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 48 (C48R)
Ref Sequence ENSEMBL: ENSMUSP00000025183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025183] [ENSMUST00000025186] [ENSMUST00000045467] [ENSMUST00000114303] [ENSMUST00000169397]
AlphaFold O35730
Predicted Effect probably damaging
Transcript: ENSMUST00000025183
AA Change: C48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025183
Gene: ENSMUSG00000024325
AA Change: C48R

DomainStartEndE-ValueType
RING 48 87 7.92e-8 SMART
low complexity region 171 229 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
Pfam:RAWUL 272 400 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025186
SMART Domains Protein: ENSMUSP00000025186
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 2.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045467
SMART Domains Protein: ENSMUSP00000038069
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 201 1.5e-16 PFAM
Pfam:adh_short 10 213 4.5e-52 PFAM
Pfam:adh_short_C2 16 258 8.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114303
SMART Domains Protein: ENSMUSP00000133546
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 202 5.5e-16 PFAM
Pfam:adh_short 22 193 2.7e-30 PFAM
Pfam:adh_short_C2 23 234 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169397
SMART Domains Protein: ENSMUSP00000130102
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 1.9e-81 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RING finger family, members of which encode proteins characterized by a RING domain, a zinc-binding motif related to the zinc finger domain. The gene product can bind DNA and can act as a transcriptional repressor. It is associated with the multimeric polycomb group protein complex. The gene product interacts with the polycomb group proteins BMI1, EDR1, and CBX4, and colocalizes with these proteins in large nuclear domains. It interacts with the CBX4 protein via its glycine-rich C-terminal domain. The gene maps to the HLA class II region, where it is contiguous with the RING finger genes FABGL and HKE4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both homozygous and heterozygous mutant mice show axial skeleton defects including anterior transformations of vertebrae and rib abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,186,425 (GRCm39) T535S probably benign Het
Adamts19 A T 18: 58,970,712 (GRCm39) R99* probably null Het
Alg6 C T 4: 99,650,198 (GRCm39) L473F possibly damaging Het
Ankar A T 1: 72,695,272 (GRCm39) N893K probably benign Het
Ankrd54 G A 15: 78,939,739 (GRCm39) A183V possibly damaging Het
Anpep G T 7: 79,491,542 (GRCm39) T153K probably benign Het
Arap1 A G 7: 101,058,564 (GRCm39) probably null Het
Aspg A T 12: 112,089,387 (GRCm39) T392S probably benign Het
B230307C23Rik A C 16: 97,811,331 (GRCm39) R68S probably benign Het
Bdp1 G C 13: 100,196,002 (GRCm39) N1253K probably damaging Het
Ccrl2 G A 9: 110,884,682 (GRCm39) S272F probably damaging Het
Cdon T C 9: 35,398,205 (GRCm39) L974P probably damaging Het
Celsr1 C A 15: 85,916,856 (GRCm39) E372D probably benign Het
Cers1 A T 8: 70,768,555 (GRCm39) M16L possibly damaging Het
Col2a1 G T 15: 97,874,022 (GRCm39) Q1387K unknown Het
Ddx39b G A 17: 35,471,726 (GRCm39) V291M probably damaging Het
Dppa2 T A 16: 48,136,076 (GRCm39) S143T probably benign Het
Dpy19l1 A T 9: 24,334,419 (GRCm39) M583K possibly damaging Het
Eno3 A T 11: 70,552,245 (GRCm39) D299V possibly damaging Het
Epha8 C T 4: 136,658,469 (GRCm39) V969M probably damaging Het
Fcgbp A T 7: 27,791,358 (GRCm39) H873L probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Fntb A C 12: 76,934,649 (GRCm39) N173T possibly damaging Het
Gins2 T A 8: 121,308,880 (GRCm39) M125L probably benign Het
Gys1 G A 7: 45,089,437 (GRCm39) A199T probably damaging Het
Herpud1 C A 8: 95,117,391 (GRCm39) H116N probably benign Het
Hoga1 C A 19: 42,048,685 (GRCm39) Y134* probably null Het
Il10ra A G 9: 45,167,522 (GRCm39) I343T probably benign Het
Inava T C 1: 136,147,935 (GRCm39) K339R possibly damaging Het
Inpp5j C T 11: 3,450,133 (GRCm39) probably null Het
Itpkb T C 1: 180,160,695 (GRCm39) S274P probably damaging Het
Kalrn C T 16: 34,177,418 (GRCm39) C249Y probably damaging Het
Klhl35 G C 7: 99,117,665 (GRCm39) A70P possibly damaging Het
Lhx1 A G 11: 84,411,108 (GRCm39) probably null Het
Lmbrd1 T C 1: 24,732,047 (GRCm39) V88A probably benign Het
Macc1 T G 12: 119,411,190 (GRCm39) L653V probably damaging Het
Madd T C 2: 91,007,452 (GRCm39) D220G probably damaging Het
Mllt10 T A 2: 18,164,371 (GRCm39) H300Q possibly damaging Het
Mlxipl G A 5: 135,161,169 (GRCm39) A363T possibly damaging Het
Mus81 G T 19: 5,537,821 (GRCm39) D78E probably benign Het
Mxd1 A T 6: 86,630,141 (GRCm39) L26M probably damaging Het
Nhsl1 C T 10: 18,402,251 (GRCm39) T1159M probably damaging Het
Nos1ap A G 1: 170,165,694 (GRCm39) S190P possibly damaging Het
Nwd1 A C 8: 73,393,322 (GRCm39) D195A probably damaging Het
Or12d13 G T 17: 37,647,352 (GRCm39) T257N probably benign Het
Or6k4 A T 1: 173,964,376 (GRCm39) D22V probably benign Het
Or8c14-ps1 G A 9: 38,101,392 (GRCm39) V124I probably damaging Het
Or8k24 T A 2: 86,216,569 (GRCm39) R64S possibly damaging Het
Otof T C 5: 30,545,700 (GRCm39) D500G possibly damaging Het
Pcgf5 T A 19: 36,420,339 (GRCm39) Y190* probably null Het
Pdcd11 C T 19: 47,099,418 (GRCm39) T839I probably benign Het
Ppard G C 17: 28,517,886 (GRCm39) S318T probably benign Het
Ppfia2 A G 10: 106,597,970 (GRCm39) K178E probably damaging Het
Ppm1n G T 7: 19,013,187 (GRCm39) R255S probably damaging Het
Ppp1r21 A G 17: 88,887,972 (GRCm39) Y693C probably damaging Het
Ppp2r5d A T 17: 46,998,279 (GRCm39) V169E possibly damaging Het
Prc1 A T 7: 79,954,121 (GRCm39) T53S probably benign Het
Pwp2 A C 10: 78,009,084 (GRCm39) probably null Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rpap1 T C 2: 119,604,043 (GRCm39) D496G probably damaging Het
Rspo4 C A 2: 151,714,998 (GRCm39) Q212K unknown Het
Samd9l T A 6: 3,372,716 (GRCm39) D1515V probably damaging Het
Serinc3 T C 2: 163,478,879 (GRCm39) T83A probably benign Het
Setd5 A C 6: 113,094,343 (GRCm39) D420A probably damaging Het
Sidt2 T C 9: 45,864,544 (GRCm39) T62A possibly damaging Het
Smarcal1 T C 1: 72,652,101 (GRCm39) V621A probably damaging Het
Srcin1 A G 11: 97,464,711 (GRCm39) L12P probably damaging Het
Stx18 G A 5: 38,278,599 (GRCm39) D165N possibly damaging Het
Sumf2 A G 5: 129,883,341 (GRCm39) K139E possibly damaging Het
Tdo2 A T 3: 81,876,866 (GRCm39) I102N probably damaging Het
Tdp1 T A 12: 99,877,947 (GRCm39) S410T probably benign Het
Tmem94 A T 11: 115,683,764 (GRCm39) I726F probably damaging Het
Ttc21a A G 9: 119,795,742 (GRCm39) E1192G probably damaging Het
Ttc8 T C 12: 98,909,726 (GRCm39) I52T probably benign Het
Vmn2r99 A T 17: 19,614,826 (GRCm39) R849* probably null Het
Wwc1 T C 11: 35,806,003 (GRCm39) K77E possibly damaging Het
Xirp2 A T 2: 67,345,952 (GRCm39) E2731V probably damaging Het
Zfp1006 A C 8: 129,945,613 (GRCm39) I404R probably benign Het
Zfp423 G A 8: 88,509,507 (GRCm39) T258I probably damaging Het
Other mutations in Ring1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ring1 APN 17 34,241,983 (GRCm39) missense possibly damaging 0.89
IGL01734:Ring1 APN 17 34,242,294 (GRCm39) missense probably damaging 1.00
IGL02420:Ring1 APN 17 34,242,122 (GRCm39) missense possibly damaging 0.67
R4711:Ring1 UTSW 17 34,241,333 (GRCm39) missense possibly damaging 0.72
R4762:Ring1 UTSW 17 34,240,971 (GRCm39) unclassified probably benign
R4770:Ring1 UTSW 17 34,242,361 (GRCm39) missense probably damaging 1.00
R4779:Ring1 UTSW 17 34,241,263 (GRCm39) unclassified probably benign
R4935:Ring1 UTSW 17 34,242,016 (GRCm39) missense probably benign 0.04
R5561:Ring1 UTSW 17 34,240,432 (GRCm39) missense possibly damaging 0.85
R5772:Ring1 UTSW 17 34,241,282 (GRCm39) missense possibly damaging 0.96
R6235:Ring1 UTSW 17 34,242,280 (GRCm39) missense probably damaging 0.98
R7115:Ring1 UTSW 17 34,242,420 (GRCm39) missense probably damaging 0.97
R7363:Ring1 UTSW 17 34,243,336 (GRCm39) missense possibly damaging 0.68
R7380:Ring1 UTSW 17 34,240,694 (GRCm39) missense probably damaging 0.98
R7556:Ring1 UTSW 17 34,240,688 (GRCm39) missense possibly damaging 0.52
R7703:Ring1 UTSW 17 34,242,109 (GRCm39) missense probably damaging 1.00
R9289:Ring1 UTSW 17 34,241,547 (GRCm39) missense possibly damaging 0.73
R9716:Ring1 UTSW 17 34,240,420 (GRCm39) missense possibly damaging 0.85
Z1177:Ring1 UTSW 17 34,240,752 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGCACTCCTTGTTCCTG -3'
(R):5'- TTGTAAATGGGCCCTCATCC -3'

Sequencing Primer
(F):5'- AAGGGAGCTCTGTAGGGCC -3'
(R):5'- GTTCTGGTAATCTCCAAGTCATTG -3'
Posted On 2019-05-13