Incidental Mutation 'R7060:Olfr103'
ID548226
Institutional Source Beutler Lab
Gene Symbol Olfr103
Ensembl Gene ENSMUSG00000049618
Gene Nameolfactory receptor 103
SynonymsMOR250-3, GA_x6K02T2PSCP-1798423-1797482, MOR250-8_p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7060 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37334303-37339698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37336461 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 257 (T257N)
Ref Sequence ENSEMBL: ENSMUSP00000134539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058826] [ENSMUST00000173472]
Predicted Effect probably benign
Transcript: ENSMUST00000058826
AA Change: T257N

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000094934
Gene: ENSMUSG00000049618
AA Change: T257N

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 3.5e-52 PFAM
Pfam:7tm_1 39 289 3.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173472
AA Change: T257N

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134539
Gene: ENSMUSG00000049618
AA Change: T257N

DomainStartEndE-ValueType
Pfam:7tm_1 39 289 2.8e-31 PFAM
Pfam:7tm_4 137 282 1.1e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A C 8: 129,219,132 I404R probably benign Het
5730559C18Rik T C 1: 136,220,197 K339R possibly damaging Het
Abcg4 T A 9: 44,275,128 T535S probably benign Het
Adamts19 A T 18: 58,837,640 R99* probably null Het
Alg6 C T 4: 99,761,961 L473F possibly damaging Het
Ankar A T 1: 72,656,113 N893K probably benign Het
Ankrd54 G A 15: 79,055,539 A183V possibly damaging Het
Anpep G T 7: 79,841,794 T153K probably benign Het
Arap1 A G 7: 101,409,357 probably null Het
Aspg A T 12: 112,122,953 T392S probably benign Het
B230307C23Rik A C 16: 98,010,131 R68S probably benign Het
Bdp1 G C 13: 100,059,494 N1253K probably damaging Het
Ccrl2 G A 9: 111,055,614 S272F probably damaging Het
Cdon T C 9: 35,486,909 L974P probably damaging Het
Celsr1 C A 15: 86,032,655 E372D probably benign Het
Cers1 A T 8: 70,315,905 M16L possibly damaging Het
Col2a1 G T 15: 97,976,141 Q1387K unknown Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dppa2 T A 16: 48,315,713 S143T probably benign Het
Dpy19l1 A T 9: 24,423,123 M583K possibly damaging Het
Eno3 A T 11: 70,661,419 D299V possibly damaging Het
Epha8 C T 4: 136,931,158 V969M probably damaging Het
Fcgbp A T 7: 28,091,933 H873L probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fntb A C 12: 76,887,875 N173T possibly damaging Het
Gins2 T A 8: 120,582,141 M125L probably benign Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Herpud1 C A 8: 94,390,763 H116N probably benign Het
Hoga1 C A 19: 42,060,246 Y134* probably null Het
Il10ra A G 9: 45,256,224 I343T probably benign Het
Inpp5j C T 11: 3,500,133 probably null Het
Itpkb T C 1: 180,333,130 S274P probably damaging Het
Kalrn C T 16: 34,357,048 C249Y probably damaging Het
Klhl35 G C 7: 99,468,458 A70P possibly damaging Het
Lhx1 A G 11: 84,520,282 probably null Het
Lmbrd1 T C 1: 24,692,966 V88A probably benign Het
Macc1 T G 12: 119,447,455 L653V probably damaging Het
Madd T C 2: 91,177,107 D220G probably damaging Het
Mllt10 T A 2: 18,159,560 H300Q possibly damaging Het
Mlxipl G A 5: 135,132,315 A363T possibly damaging Het
Mus81 G T 19: 5,487,793 D78E probably benign Het
Mxd1 A T 6: 86,653,159 L26M probably damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Nos1ap A G 1: 170,338,125 S190P possibly damaging Het
Nwd1 A C 8: 72,666,694 D195A probably damaging Het
Olfr1058 T A 2: 86,386,225 R64S possibly damaging Het
Olfr424 A T 1: 174,136,810 D22V probably benign Het
Olfr892-ps1 G A 9: 38,190,096 V124I probably damaging Het
Otof T C 5: 30,388,356 D500G possibly damaging Het
Pcgf5 T A 19: 36,442,939 Y190* probably null Het
Pdcd11 C T 19: 47,110,979 T839I probably benign Het
Ppard G C 17: 28,298,912 S318T probably benign Het
Ppfia2 A G 10: 106,762,109 K178E probably damaging Het
Ppm1n G T 7: 19,279,262 R255S probably damaging Het
Ppp1r21 A G 17: 88,580,544 Y693C probably damaging Het
Ppp2r5d A T 17: 46,687,353 V169E possibly damaging Het
Prc1 A T 7: 80,304,373 T53S probably benign Het
Pwp2 A C 10: 78,173,250 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Ring1 A G 17: 34,023,390 C48R probably damaging Het
Rpap1 T C 2: 119,773,562 D496G probably damaging Het
Rspo4 C A 2: 151,873,078 Q212K unknown Het
Samd9l T A 6: 3,372,716 D1515V probably damaging Het
Serinc3 T C 2: 163,636,959 T83A probably benign Het
Setd5 A C 6: 113,117,382 D420A probably damaging Het
Sidt2 T C 9: 45,953,246 T62A possibly damaging Het
Smarcal1 T C 1: 72,612,942 V621A probably damaging Het
Srcin1 A G 11: 97,573,885 L12P probably damaging Het
Stx18 G A 5: 38,121,255 D165N possibly damaging Het
Sumf2 A G 5: 129,854,500 K139E possibly damaging Het
Tdo2 A T 3: 81,969,559 I102N probably damaging Het
Tdp1 T A 12: 99,911,688 S410T probably benign Het
Tmem94 A T 11: 115,792,938 I726F probably damaging Het
Ttc21a A G 9: 119,966,676 E1192G probably damaging Het
Ttc8 T C 12: 98,943,467 I52T probably benign Het
Vmn2r99 A T 17: 19,394,564 R849* probably null Het
Wwc1 T C 11: 35,915,176 K77E possibly damaging Het
Xirp2 A T 2: 67,515,608 E2731V probably damaging Het
Zfp423 G A 8: 87,782,879 T258I probably damaging Het
Other mutations in Olfr103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Olfr103 APN 17 37336583 nonsense probably null
IGL01953:Olfr103 APN 17 37336875 missense probably damaging 1.00
IGL02556:Olfr103 APN 17 37336996 missense probably benign 0.00
IGL02574:Olfr103 APN 17 37336524 missense probably damaging 1.00
IGL02737:Olfr103 APN 17 37336773 missense possibly damaging 0.94
IGL02995:Olfr103 APN 17 37336709 missense probably damaging 1.00
R1078:Olfr103 UTSW 17 37337026 missense probably damaging 0.98
R1466:Olfr103 UTSW 17 37336956 missense probably benign 0.43
R1466:Olfr103 UTSW 17 37336956 missense probably benign 0.43
R3024:Olfr103 UTSW 17 37337027 missense probably damaging 1.00
R3858:Olfr103 UTSW 17 37337226 nonsense probably null
R4979:Olfr103 UTSW 17 37336868 missense probably benign 0.06
R5062:Olfr103 UTSW 17 37336931 missense probably damaging 0.99
R5215:Olfr103 UTSW 17 37336813 missense probably benign 0.00
R5441:Olfr103 UTSW 17 37336268 splice site probably null
R5453:Olfr103 UTSW 17 37337062 missense possibly damaging 0.96
R5525:Olfr103 UTSW 17 37336626 missense probably damaging 0.99
R5660:Olfr103 UTSW 17 37336644 missense probably damaging 1.00
R5859:Olfr103 UTSW 17 37336369 missense possibly damaging 0.61
R6211:Olfr103 UTSW 17 37336708 missense possibly damaging 0.90
R6958:Olfr103 UTSW 17 37336417 missense probably benign
R7567:Olfr103 UTSW 17 37337171 missense probably benign 0.00
R7784:Olfr103 UTSW 17 37336578 missense probably benign 0.13
R7784:Olfr103 UTSW 17 37337055 missense probably damaging 0.99
R7978:Olfr103 UTSW 17 37336501 missense probably benign 0.00
R8284:Olfr103 UTSW 17 37336696 missense probably benign 0.01
R8419:Olfr103 UTSW 17 37336575 missense possibly damaging 0.75
R8957:Olfr103 UTSW 17 37336491 missense probably damaging 1.00
Z1088:Olfr103 UTSW 17 37336705 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGCCTGGTTATTTACACCTCAGTAG -3'
(R):5'- CAACCTTTGGCTGCTTAATACCG -3'

Sequencing Primer
(F):5'- TGGTTATTTACACCTCAGTAGAGTTC -3'
(R):5'- GGCTGCTTAATACCGTTACAGG -3'
Posted On2019-05-13