Incidental Mutation 'R7060:Ppp1r21'
ID548228
Institutional Source Beutler Lab
Gene Symbol Ppp1r21
Ensembl Gene ENSMUSG00000034709
Gene Nameprotein phosphatase 1, regulatory subunit 21
SynonymsKlraq1, 1110018J12Rik, Ccdc128
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R7060 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location88530118-88588367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88580544 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 693 (Y693C)
Ref Sequence ENSEMBL: ENSMUSP00000048443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038551]
Predicted Effect probably damaging
Transcript: ENSMUST00000038551
AA Change: Y693C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048443
Gene: ENSMUSG00000034709
AA Change: Y693C

DomainStartEndE-ValueType
KLRAQ 11 112 8.01e-51 SMART
coiled coil region 136 211 N/A INTRINSIC
Pfam:TTKRSYEDQ 255 771 1.8e-273 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (78/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A C 8: 129,219,132 I404R probably benign Het
5730559C18Rik T C 1: 136,220,197 K339R possibly damaging Het
Abcg4 T A 9: 44,275,128 T535S probably benign Het
Adamts19 A T 18: 58,837,640 R99* probably null Het
Alg6 C T 4: 99,761,961 L473F possibly damaging Het
Ankar A T 1: 72,656,113 N893K probably benign Het
Ankrd54 G A 15: 79,055,539 A183V possibly damaging Het
Anpep G T 7: 79,841,794 T153K probably benign Het
Arap1 A G 7: 101,409,357 probably null Het
Aspg A T 12: 112,122,953 T392S probably benign Het
B230307C23Rik A C 16: 98,010,131 R68S probably benign Het
Bdp1 G C 13: 100,059,494 N1253K probably damaging Het
Ccrl2 G A 9: 111,055,614 S272F probably damaging Het
Cdon T C 9: 35,486,909 L974P probably damaging Het
Celsr1 C A 15: 86,032,655 E372D probably benign Het
Cers1 A T 8: 70,315,905 M16L possibly damaging Het
Col2a1 G T 15: 97,976,141 Q1387K unknown Het
Ddx39b G A 17: 35,252,750 V291M probably damaging Het
Dppa2 T A 16: 48,315,713 S143T probably benign Het
Dpy19l1 A T 9: 24,423,123 M583K possibly damaging Het
Eno3 A T 11: 70,661,419 D299V possibly damaging Het
Epha8 C T 4: 136,931,158 V969M probably damaging Het
Fcgbp A T 7: 28,091,933 H873L probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fntb A C 12: 76,887,875 N173T possibly damaging Het
Gins2 T A 8: 120,582,141 M125L probably benign Het
Gys1 G A 7: 45,440,013 A199T probably damaging Het
Herpud1 C A 8: 94,390,763 H116N probably benign Het
Hoga1 C A 19: 42,060,246 Y134* probably null Het
Il10ra A G 9: 45,256,224 I343T probably benign Het
Inpp5j C T 11: 3,500,133 probably null Het
Itpkb T C 1: 180,333,130 S274P probably damaging Het
Kalrn C T 16: 34,357,048 C249Y probably damaging Het
Klhl35 G C 7: 99,468,458 A70P possibly damaging Het
Lhx1 A G 11: 84,520,282 probably null Het
Lmbrd1 T C 1: 24,692,966 V88A probably benign Het
Macc1 T G 12: 119,447,455 L653V probably damaging Het
Madd T C 2: 91,177,107 D220G probably damaging Het
Mllt10 T A 2: 18,159,560 H300Q possibly damaging Het
Mlxipl G A 5: 135,132,315 A363T possibly damaging Het
Mus81 G T 19: 5,487,793 D78E probably benign Het
Mxd1 A T 6: 86,653,159 L26M probably damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Nos1ap A G 1: 170,338,125 S190P possibly damaging Het
Nwd1 A C 8: 72,666,694 D195A probably damaging Het
Olfr103 G T 17: 37,336,461 T257N probably benign Het
Olfr1058 T A 2: 86,386,225 R64S possibly damaging Het
Olfr424 A T 1: 174,136,810 D22V probably benign Het
Olfr892-ps1 G A 9: 38,190,096 V124I probably damaging Het
Otof T C 5: 30,388,356 D500G possibly damaging Het
Pcgf5 T A 19: 36,442,939 Y190* probably null Het
Pdcd11 C T 19: 47,110,979 T839I probably benign Het
Ppard G C 17: 28,298,912 S318T probably benign Het
Ppfia2 A G 10: 106,762,109 K178E probably damaging Het
Ppm1n G T 7: 19,279,262 R255S probably damaging Het
Ppp2r5d A T 17: 46,687,353 V169E possibly damaging Het
Prc1 A T 7: 80,304,373 T53S probably benign Het
Pwp2 A C 10: 78,173,250 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Ring1 A G 17: 34,023,390 C48R probably damaging Het
Rpap1 T C 2: 119,773,562 D496G probably damaging Het
Rspo4 C A 2: 151,873,078 Q212K unknown Het
Samd9l T A 6: 3,372,716 D1515V probably damaging Het
Serinc3 T C 2: 163,636,959 T83A probably benign Het
Setd5 A C 6: 113,117,382 D420A probably damaging Het
Sidt2 T C 9: 45,953,246 T62A possibly damaging Het
Smarcal1 T C 1: 72,612,942 V621A probably damaging Het
Srcin1 A G 11: 97,573,885 L12P probably damaging Het
Stx18 G A 5: 38,121,255 D165N possibly damaging Het
Sumf2 A G 5: 129,854,500 K139E possibly damaging Het
Tdo2 A T 3: 81,969,559 I102N probably damaging Het
Tdp1 T A 12: 99,911,688 S410T probably benign Het
Tmem94 A T 11: 115,792,938 I726F probably damaging Het
Ttc21a A G 9: 119,966,676 E1192G probably damaging Het
Ttc8 T C 12: 98,943,467 I52T probably benign Het
Vmn2r99 A T 17: 19,394,564 R849* probably null Het
Wwc1 T C 11: 35,915,176 K77E possibly damaging Het
Xirp2 A T 2: 67,515,608 E2731V probably damaging Het
Zfp423 G A 8: 87,782,879 T258I probably damaging Het
Other mutations in Ppp1r21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Ppp1r21 APN 17 88562102 splice site probably benign
IGL02366:Ppp1r21 APN 17 88547662 missense probably damaging 0.99
IGL02604:Ppp1r21 APN 17 88572743 missense probably benign 0.00
IGL02680:Ppp1r21 APN 17 88583862 missense probably benign 0.00
R0266:Ppp1r21 UTSW 17 88569072 splice site probably benign
R0436:Ppp1r21 UTSW 17 88565689 missense possibly damaging 0.96
R1398:Ppp1r21 UTSW 17 88542879 missense probably damaging 1.00
R1472:Ppp1r21 UTSW 17 88558605 missense probably damaging 1.00
R1599:Ppp1r21 UTSW 17 88572627 missense probably benign 0.00
R1677:Ppp1r21 UTSW 17 88550669 missense probably benign 0.04
R1760:Ppp1r21 UTSW 17 88562225 missense possibly damaging 0.78
R2571:Ppp1r21 UTSW 17 88545382 missense probably benign 0.06
R3700:Ppp1r21 UTSW 17 88582454 missense possibly damaging 0.88
R3786:Ppp1r21 UTSW 17 88577127 splice site probably null
R3959:Ppp1r21 UTSW 17 88549816 missense probably damaging 1.00
R4649:Ppp1r21 UTSW 17 88549513 missense probably benign
R4654:Ppp1r21 UTSW 17 88558799 missense probably benign 0.01
R4724:Ppp1r21 UTSW 17 88555591 nonsense probably null
R4766:Ppp1r21 UTSW 17 88572615 missense probably benign 0.00
R4933:Ppp1r21 UTSW 17 88547621 missense probably benign 0.07
R4934:Ppp1r21 UTSW 17 88545375 missense probably damaging 1.00
R4934:Ppp1r21 UTSW 17 88545376 missense probably damaging 0.98
R4992:Ppp1r21 UTSW 17 88569080 missense probably benign 0.44
R5109:Ppp1r21 UTSW 17 88558840 missense probably damaging 1.00
R5372:Ppp1r21 UTSW 17 88550675 missense probably benign 0.21
R5861:Ppp1r21 UTSW 17 88582509 missense probably damaging 1.00
R6200:Ppp1r21 UTSW 17 88569185 missense possibly damaging 0.65
R6369:Ppp1r21 UTSW 17 88582412 splice site probably null
R7154:Ppp1r21 UTSW 17 88554886 missense probably damaging 0.99
R7390:Ppp1r21 UTSW 17 88549530 missense probably benign 0.26
R7470:Ppp1r21 UTSW 17 88562221 missense probably damaging 1.00
R7475:Ppp1r21 UTSW 17 88555603 missense probably benign 0.07
R7657:Ppp1r21 UTSW 17 88555682 missense probably damaging 1.00
R8021:Ppp1r21 UTSW 17 88549507 missense probably benign 0.00
R8081:Ppp1r21 UTSW 17 88558844 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTGCCAGAATTGCCCTG -3'
(R):5'- CTCTGGCAGGAACTTGGACATG -3'

Sequencing Primer
(F):5'- AGAATTGCCCTGCTCACTGG -3'
(R):5'- ATGAACATTCTGGAGCGGCTC -3'
Posted On2019-05-13