Mutagenetix > Incidental Mutation

Incidental Mutation 'R7061:Mybpc3'

548240

Institutional Source

Beutler Lab

Gene Symbol

Mybpc3

Ensembl Gene

ENSMUSG00000002100

Gene Name

myosin binding protein C, cardiac

Synonyms

cardiac C-protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.617) question?

Stock #

R7061 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91118144-91136516 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91125404 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 594 (I594M)

Ref Sequence

ENSEMBL: ENSMUSP00000127070 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111430] [ENSMUST00000137942] [ENSMUST00000169776]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111430
AA Change: I593M

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107058
Gene: ENSMUSG00000002100
AA Change: I593M

Domain	Start	End	E-Value	Type
IG	24	103	4.86e-2	SMART
low complexity region	131	143	N/A	INTRINSIC
IG	167	263	2.81e-7	SMART
IG	373	453	1.25e-4	SMART
IG	463	544	2.48e-8	SMART
IG	554	640	3.16e-1	SMART
IG	659	772	3.91e-6	SMART
FN3	775	858	2.5e-11	SMART
FN3	873	956	7.06e-11	SMART
IG	983	1066	3.3e-4	SMART
FN3	1069	1151	4.38e-7	SMART
IGc2	1196	1263	6.21e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137942
AA Change: I429M

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000119994
Gene: ENSMUSG00000002100
AA Change: I429M

Domain	Start	End	E-Value	Type
IG	3	99	2.81e-7	SMART
low complexity region	135	152	N/A	INTRINSIC
IG	209	289	1.25e-4	SMART
IG	299	380	2.48e-8	SMART
IG	390	476	3.16e-1	SMART
IG	495	608	3.91e-6	SMART
FN3	611	694	2.5e-11	SMART
FN3	709	792	7.06e-11	SMART
IG	819	902	3.3e-4	SMART
FN3	905	987	4.38e-7	SMART
IGc2	1032	1099	6.21e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169776
AA Change: I594M

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127070
Gene: ENSMUSG00000002100
AA Change: I594M

Domain	Start	End	E-Value	Type
IG	24	103	4.86e-2	SMART
low complexity region	131	143	N/A	INTRINSIC
IG	167	263	2.81e-7	SMART
IG	374	454	1.25e-4	SMART
IG	464	545	2.48e-8	SMART
IG	555	641	3.16e-1	SMART
IG	660	773	3.91e-6	SMART
FN3	776	859	2.5e-11	SMART
FN3	874	957	7.06e-11	SMART
IG	984	1067	3.3e-4	SMART
FN3	1070	1152	4.38e-7	SMART
IGc2	1197	1264	6.21e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3, the cardiac isoform, is expressed exclussively in heart muscle. Regulatory phosphorylation of the cardiac isoform in vivo by cAMP-dependent protein kinase (PKA) upon adrenergic stimulation may be linked to modulation of cardiac contraction. Mutations in MYBPC3 are one cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null or truncated mutations exhibit cardiac abnormalities such as cardiac hypertrophy, dilated cardiomyopathy, abnormal cardiac muscle contractility and relaxation, disorganized myocardium, and cardiac fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,545,065	M660T	probably benign	Het
Aard	G	A	15: 52,040,221	M13I	probably benign	Het
Abcb5	A	C	12: 118,877,774	Y979D	probably damaging	Het
Adgrb1	G	C	15: 74,569,881	V4L	probably benign	Het
Ap3b2	C	T	7: 81,461,009	R1006Q	unknown	Het
Bpifa6	A	T	2: 153,992,316	T343S	probably benign	Het
Celsr3	T	A	9: 108,847,594	C2957*	probably null	Het
Chd6	G	A	2: 161,025,965	Q428*	probably null	Het
Col5a1	C	A	2: 28,025,678	C191*	probably null	Het
Cpox	A	G	16: 58,670,860	I145V	possibly damaging	Het
Csnk2a1	C	T	2: 152,274,171	R268C	probably benign	Het
Dclk2	A	G	3: 86,831,731		probably null	Het
Dennd5a	T	C	7: 109,905,179	E909G	probably benign	Het
Depdc1a	T	A	3: 159,522,852	S414T	possibly damaging	Het
Dock5	A	G	14: 67,770,254	F1502S	probably damaging	Het
Dopey2	G	T	16: 93,762,063	A448S	probably benign	Het
Dsg1c	C	A	18: 20,277,009	N511K	probably benign	Het
Epc2	G	T	2: 49,535,322	R108L	probably damaging	Het
Erp44	T	A	4: 48,219,375	I147F	probably benign	Het
Evc	T	C	5: 37,319,102	T368A	possibly damaging	Het
Fbxo41	G	T	6: 85,475,466	R738S	probably benign	Het
Fli1	T	C	9: 32,424,222	T305A	probably damaging	Het
Gm4969	A	T	7: 19,100,128		probably benign	Het
Gm8897	T	C	5: 11,419,104	V74A	possibly damaging	Het
Grk5	A	G	19: 61,046,092	T93A	probably benign	Het
Grm2	A	T	9: 106,651,225	N153K	probably damaging	Het
Helz	A	G	11: 107,649,177	T1007A	possibly damaging	Het
Helz2	A	G	2: 181,240,514	L162P	probably damaging	Het
Hmgcr	T	A	13: 96,666,148	Q81L	possibly damaging	Het
Hnrnpu	T	C	1: 178,336,126	K218E	unknown	Het
Hydin	A	T	8: 110,603,288	I4885F	possibly damaging	Het
Ibsp	A	G	5: 104,309,902		probably null	Het
Igfals	T	C	17: 24,880,307	L124P	probably damaging	Het
Il24	T	A	1: 130,883,371	H142L	possibly damaging	Het
Kcnh2	A	T	5: 24,331,922	H221Q	probably benign	Het
Man1a	A	G	10: 53,920,235	S454P	probably damaging	Het
Mfsd4b1	C	T	10: 40,003,386	V172M	possibly damaging	Het
Mical2	T	A	7: 112,346,801	I763K	probably benign	Het
Neo1	T	A	9: 58,990,441	R77S	possibly damaging	Het
Nlrp6	A	G	7: 140,922,867	I265M	probably benign	Het
Olfr1350	A	G	7: 6,570,783	Y264C	probably damaging	Het
Olfr669	T	C	7: 104,938,676	L50P	probably damaging	Het
Olfr877	T	A	9: 37,855,646	V276D	possibly damaging	Het
Pcdhgb5	C	A	18: 37,731,923	P257Q	probably benign	Het
Phactr1	A	G	13: 43,132,981	D586G	probably damaging	Het
Pkn3	T	A	2: 30,083,536		probably null	Het
Prob1	A	T	18: 35,654,500	S234T	probably benign	Het
Rab14	A	T	2: 35,183,417	L131*	probably null	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rhebl1	A	G	15: 98,879,283	L103P	probably damaging	Het
Rnf10	G	T	5: 115,257,090	F146L	probably damaging	Het
Rrbp1	T	C	2: 143,989,167	K360R	possibly damaging	Het
Slc6a9	C	T	4: 117,868,064	T575I	probably benign	Het
Smo	A	G	6: 29,760,230	H776R	probably damaging	Het
Tns2	A	G	15: 102,104,479	M1V	probably null	Het
Ttn	C	A	2: 76,894,692		probably benign	Het
Ugt3a1	A	T	15: 9,306,154	M130L	probably benign	Het
Urb2	C	T	8: 124,028,297	H248Y	probably benign	Het
Vit	A	T	17: 78,625,156	N564I	probably damaging	Het
Vmn1r60	A	T	7: 5,544,311	Y263*	probably null	Het
Vmn2r16	A	T	5: 109,363,754	Y609F	probably damaging	Het
Xpo7	T	C	14: 70,671,072	I876V	probably benign	Het
Zfp442	A	G	2: 150,408,017	I655T	probably benign	Het
Zfp574	T	A	7: 25,080,197	C215S	possibly damaging	Het
Zfp608	T	C	18: 54,987,997	T173A	probably benign	Het
Zfp69	A	T	4: 120,931,401	V239D	possibly damaging	Het

Other mutations in Mybpc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Mybpc3	APN	2	91120029	missense	probably benign
IGL00985:Mybpc3	APN	2	91135359	missense	probably benign	0.16
IGL01926:Mybpc3	APN	2	91135407	missense	possibly damaging	0.61
IGL02135:Mybpc3	APN	2	91124826	missense	possibly damaging	0.58
IGL02187:Mybpc3	APN	2	91135452	missense	probably benign
IGL02219:Mybpc3	APN	2	91121023	critical splice acceptor site	probably null
IGL02752:Mybpc3	APN	2	91132637	critical splice acceptor site	probably null
IGL03002:Mybpc3	APN	2	91123889	missense	probably damaging	1.00
IGL03118:Mybpc3	APN	2	91124503	missense	probably damaging	1.00
IGL03238:Mybpc3	APN	2	91131659	missense	probably damaging	1.00
amanitin	UTSW	2	91118179	missense	probably null	0.98
fungus	UTSW	2	91123961	missense	possibly damaging	0.87
R0010:Mybpc3	UTSW	2	91134833	nonsense	probably null
R0114:Mybpc3	UTSW	2	91124494	missense	probably damaging	1.00
R0139:Mybpc3	UTSW	2	91120337	splice site	probably benign
R0282:Mybpc3	UTSW	2	91124024	splice site	probably benign
R0673:Mybpc3	UTSW	2	91120427	missense	probably damaging	1.00
R1388:Mybpc3	UTSW	2	91122874	missense	probably benign	0.43
R2159:Mybpc3	UTSW	2	91125370	missense	probably damaging	1.00
R2424:Mybpc3	UTSW	2	91135793	missense	probably benign	0.20
R3983:Mybpc3	UTSW	2	91135369	missense	probably benign
R4322:Mybpc3	UTSW	2	91123961	missense	possibly damaging	0.87
R4909:Mybpc3	UTSW	2	91134812	missense	probably benign
R4913:Mybpc3	UTSW	2	91126264	missense	possibly damaging	0.46
R4965:Mybpc3	UTSW	2	91119247	missense	possibly damaging	0.50
R5248:Mybpc3	UTSW	2	91125228	splice site	probably null
R5311:Mybpc3	UTSW	2	91128678	nonsense	probably null
R5332:Mybpc3	UTSW	2	91122938	missense	probably damaging	1.00
R5635:Mybpc3	UTSW	2	91134829	missense	probably benign	0.00
R5647:Mybpc3	UTSW	2	91121722	splice site	probably null
R5698:Mybpc3	UTSW	2	91124849	missense	possibly damaging	0.85
R5832:Mybpc3	UTSW	2	91119175	splice site	probably null
R5895:Mybpc3	UTSW	2	91124665	missense	probably damaging	0.99
R6833:Mybpc3	UTSW	2	91125428	splice site	probably null
R7144:Mybpc3	UTSW	2	91134604	missense	probably benign	0.03
R7169:Mybpc3	UTSW	2	91118179	missense	possibly damaging	0.85
R7472:Mybpc3	UTSW	2	91131656	missense	probably damaging	1.00
R7538:Mybpc3	UTSW	2	91120487	missense	probably damaging	1.00
R7677:Mybpc3	UTSW	2	91129031	missense	probably benign	0.04
R7955:Mybpc3	UTSW	2	91126056	splice site	probably null
R8290:Mybpc3	UTSW	2	91121128	missense	probably benign	0.00
R8486:Mybpc3	UTSW	2	91128772	missense	probably damaging	1.00
R8821:Mybpc3	UTSW	2	91118179	missense	probably null	0.98
R8885:Mybpc3	UTSW	2	91123892	missense	probably benign
R8938:Mybpc3	UTSW	2	91123949	missense	probably damaging	1.00
R9420:Mybpc3	UTSW	2	91135133	nonsense	probably null
Z1088:Mybpc3	UTSW	2	91135359	missense	probably benign	0.16
Z1176:Mybpc3	UTSW	2	91120403	missense	possibly damaging	0.85
Z1177:Mybpc3	UTSW	2	91123964	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGTCCCGTAACTGCACATACC -3'
(R):5'- TACTGCCACTGCCCAGTTTG -3'

Sequencing Primer
(F):5'- AGAGGCCTGCATACCACTG -3'
(R):5'- CCAGTTTGGGGAATGGCAG -3'

Posted On

2019-05-13