Incidental Mutation 'R7061:Mybpc3'
ID548240
Institutional Source Beutler Lab
Gene Symbol Mybpc3
Ensembl Gene ENSMUSG00000002100
Gene Namemyosin binding protein C, cardiac
Synonymscardiac C-protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91118144-91136516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91125404 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 594 (I594M)
Ref Sequence ENSEMBL: ENSMUSP00000127070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111430] [ENSMUST00000137942] [ENSMUST00000169776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111430
AA Change: I593M

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107058
Gene: ENSMUSG00000002100
AA Change: I593M

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 373 453 1.25e-4 SMART
IG 463 544 2.48e-8 SMART
IG 554 640 3.16e-1 SMART
IG 659 772 3.91e-6 SMART
FN3 775 858 2.5e-11 SMART
FN3 873 956 7.06e-11 SMART
IG 983 1066 3.3e-4 SMART
FN3 1069 1151 4.38e-7 SMART
IGc2 1196 1263 6.21e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137942
AA Change: I429M

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119994
Gene: ENSMUSG00000002100
AA Change: I429M

DomainStartEndE-ValueType
IG 3 99 2.81e-7 SMART
low complexity region 135 152 N/A INTRINSIC
IG 209 289 1.25e-4 SMART
IG 299 380 2.48e-8 SMART
IG 390 476 3.16e-1 SMART
IG 495 608 3.91e-6 SMART
FN3 611 694 2.5e-11 SMART
FN3 709 792 7.06e-11 SMART
IG 819 902 3.3e-4 SMART
FN3 905 987 4.38e-7 SMART
IGc2 1032 1099 6.21e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169776
AA Change: I594M

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127070
Gene: ENSMUSG00000002100
AA Change: I594M

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 374 454 1.25e-4 SMART
IG 464 545 2.48e-8 SMART
IG 555 641 3.16e-1 SMART
IG 660 773 3.91e-6 SMART
FN3 776 859 2.5e-11 SMART
FN3 874 957 7.06e-11 SMART
IG 984 1067 3.3e-4 SMART
FN3 1070 1152 4.38e-7 SMART
IGc2 1197 1264 6.21e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3, the cardiac isoform, is expressed exclussively in heart muscle. Regulatory phosphorylation of the cardiac isoform in vivo by cAMP-dependent protein kinase (PKA) upon adrenergic stimulation may be linked to modulation of cardiac contraction. Mutations in MYBPC3 are one cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null or truncated mutations exhibit cardiac abnormalities such as cardiac hypertrophy, dilated cardiomyopathy, abnormal cardiac muscle contractility and relaxation, disorganized myocardium, and cardiac fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Mybpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Mybpc3 APN 2 91120029 missense probably benign
IGL00985:Mybpc3 APN 2 91135359 missense probably benign 0.16
IGL01926:Mybpc3 APN 2 91135407 missense possibly damaging 0.61
IGL02135:Mybpc3 APN 2 91124826 missense possibly damaging 0.58
IGL02187:Mybpc3 APN 2 91135452 missense probably benign
IGL02219:Mybpc3 APN 2 91121023 critical splice acceptor site probably null
IGL02752:Mybpc3 APN 2 91132637 critical splice acceptor site probably null
IGL03002:Mybpc3 APN 2 91123889 missense probably damaging 1.00
IGL03118:Mybpc3 APN 2 91124503 missense probably damaging 1.00
IGL03238:Mybpc3 APN 2 91131659 missense probably damaging 1.00
R0010:Mybpc3 UTSW 2 91134833 nonsense probably null
R0114:Mybpc3 UTSW 2 91124494 missense probably damaging 1.00
R0139:Mybpc3 UTSW 2 91120337 splice site probably benign
R0282:Mybpc3 UTSW 2 91124024 splice site probably benign
R0673:Mybpc3 UTSW 2 91120427 missense probably damaging 1.00
R1388:Mybpc3 UTSW 2 91122874 missense probably benign 0.43
R2159:Mybpc3 UTSW 2 91125370 missense probably damaging 1.00
R2424:Mybpc3 UTSW 2 91135793 missense probably benign 0.20
R3983:Mybpc3 UTSW 2 91135369 missense probably benign
R4322:Mybpc3 UTSW 2 91123961 missense possibly damaging 0.87
R4909:Mybpc3 UTSW 2 91134812 missense probably benign
R4913:Mybpc3 UTSW 2 91126264 missense possibly damaging 0.46
R4965:Mybpc3 UTSW 2 91119247 missense possibly damaging 0.50
R5248:Mybpc3 UTSW 2 91125228 splice site probably null
R5311:Mybpc3 UTSW 2 91128678 nonsense probably null
R5332:Mybpc3 UTSW 2 91122938 missense probably damaging 1.00
R5635:Mybpc3 UTSW 2 91134829 missense probably benign 0.00
R5647:Mybpc3 UTSW 2 91121722 splice site probably null
R5698:Mybpc3 UTSW 2 91124849 missense possibly damaging 0.85
R5832:Mybpc3 UTSW 2 91119175 splice site probably null
R5895:Mybpc3 UTSW 2 91124665 missense probably damaging 0.99
R6833:Mybpc3 UTSW 2 91125428 splice site probably null
R7144:Mybpc3 UTSW 2 91134604 missense probably benign 0.03
R7169:Mybpc3 UTSW 2 91118179 missense possibly damaging 0.85
R7472:Mybpc3 UTSW 2 91131656 missense probably damaging 1.00
R7538:Mybpc3 UTSW 2 91120487 missense probably damaging 1.00
R7677:Mybpc3 UTSW 2 91129031 missense probably benign 0.04
R7955:Mybpc3 UTSW 2 91126056 splice site probably null
R8290:Mybpc3 UTSW 2 91121128 missense probably benign 0.00
R8486:Mybpc3 UTSW 2 91128772 missense probably damaging 1.00
R8821:Mybpc3 UTSW 2 91118179 missense probably null 0.98
Z1088:Mybpc3 UTSW 2 91135359 missense probably benign 0.16
Z1176:Mybpc3 UTSW 2 91120403 missense possibly damaging 0.85
Z1177:Mybpc3 UTSW 2 91123964 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTCCCGTAACTGCACATACC -3'
(R):5'- TACTGCCACTGCCCAGTTTG -3'

Sequencing Primer
(F):5'- AGAGGCCTGCATACCACTG -3'
(R):5'- CCAGTTTGGGGAATGGCAG -3'
Posted On2019-05-13