Incidental Mutation 'R7061:Bpifa6'
ID 548244
Institutional Source Beutler Lab
Gene Symbol Bpifa6
Ensembl Gene ENSMUSG00000078998
Gene Name BPI fold containing family A, member 6
Synonyms Gm5840
MMRRC Submission 045384-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R7061 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 153816865-153842415 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 153834236 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 343 (T343S)
Ref Sequence ENSEMBL: ENSMUSP00000105375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109753]
AlphaFold Q0VGU8
Predicted Effect probably benign
Transcript: ENSMUST00000109753
AA Change: T343S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105375
Gene: ENSMUSG00000078998
AA Change: T343S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:LBP_BPI_CETP 176 319 1.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard G A 15: 51,903,617 (GRCm39) M13I probably benign Het
Abcb5 A C 12: 118,841,509 (GRCm39) Y979D probably damaging Het
Adgrb1 G C 15: 74,441,730 (GRCm39) V4L probably benign Het
Ap3b2 C T 7: 81,110,757 (GRCm39) R1006Q unknown Het
Celsr3 T A 9: 108,724,793 (GRCm39) C2957* probably null Het
Chd6 G A 2: 160,867,885 (GRCm39) Q428* probably null Het
Col5a1 C A 2: 27,915,690 (GRCm39) C191* probably null Het
Cpox A G 16: 58,491,223 (GRCm39) I145V possibly damaging Het
Csnk2a1 C T 2: 152,116,091 (GRCm39) R268C probably benign Het
Dclk2 A G 3: 86,739,038 (GRCm39) probably null Het
Dennd5a T C 7: 109,504,386 (GRCm39) E909G probably benign Het
Depdc1a T A 3: 159,228,489 (GRCm39) S414T possibly damaging Het
Dock5 A G 14: 68,007,703 (GRCm39) F1502S probably damaging Het
Dop1b G T 16: 93,558,951 (GRCm39) A448S probably benign Het
Dsg1c C A 18: 20,410,066 (GRCm39) N511K probably benign Het
Epc2 G T 2: 49,425,334 (GRCm39) R108L probably damaging Het
Erp44 T A 4: 48,219,375 (GRCm39) I147F probably benign Het
Evc T C 5: 37,476,446 (GRCm39) T368A possibly damaging Het
Fbxo41 G T 6: 85,452,448 (GRCm39) R738S probably benign Het
Fli1 T C 9: 32,335,518 (GRCm39) T305A probably damaging Het
Grk5 A G 19: 61,034,530 (GRCm39) T93A probably benign Het
Grm2 A T 9: 106,528,424 (GRCm39) N153K probably damaging Het
Helz A G 11: 107,540,003 (GRCm39) T1007A possibly damaging Het
Helz2 A G 2: 180,882,307 (GRCm39) L162P probably damaging Het
Hmgcr T A 13: 96,802,656 (GRCm39) Q81L possibly damaging Het
Hnrnpu T C 1: 178,163,691 (GRCm39) K218E unknown Het
Hydin A T 8: 111,329,920 (GRCm39) I4885F possibly damaging Het
Ibsp A G 5: 104,457,768 (GRCm39) probably null Het
Igfals T C 17: 25,099,281 (GRCm39) L124P probably damaging Het
Il24 T A 1: 130,811,108 (GRCm39) H142L possibly damaging Het
Iqca1l A G 5: 24,750,063 (GRCm39) M660T probably benign Het
Kcnh2 A T 5: 24,536,920 (GRCm39) H221Q probably benign Het
Man1a A G 10: 53,796,331 (GRCm39) S454P probably damaging Het
Meiosin A T 7: 18,834,053 (GRCm39) probably benign Het
Mfsd4b1 C T 10: 39,879,382 (GRCm39) V172M possibly damaging Het
Mical2 T A 7: 111,946,008 (GRCm39) I763K probably benign Het
Mybpc3 A G 2: 90,955,749 (GRCm39) I594M possibly damaging Het
Neo1 T A 9: 58,897,724 (GRCm39) R77S possibly damaging Het
Nlrp6 A G 7: 140,502,780 (GRCm39) I265M probably benign Het
Or52n5 T C 7: 104,587,883 (GRCm39) L50P probably damaging Het
Or5bw2 A G 7: 6,573,782 (GRCm39) Y264C probably damaging Het
Or8b9 T A 9: 37,766,942 (GRCm39) V276D possibly damaging Het
Pcdhgb5 C A 18: 37,864,976 (GRCm39) P257Q probably benign Het
Phactr1 A G 13: 43,286,457 (GRCm39) D586G probably damaging Het
Pkn3 T A 2: 29,973,548 (GRCm39) probably null Het
Prob1 A T 18: 35,787,553 (GRCm39) S234T probably benign Het
Rab14 A T 2: 35,073,429 (GRCm39) L131* probably null Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rhebl1 A G 15: 98,777,164 (GRCm39) L103P probably damaging Het
Rnf10 G T 5: 115,395,149 (GRCm39) F146L probably damaging Het
Rrbp1 T C 2: 143,831,087 (GRCm39) K360R possibly damaging Het
Slc6a9 C T 4: 117,725,261 (GRCm39) T575I probably benign Het
Smo A G 6: 29,760,229 (GRCm39) H776R probably damaging Het
Speer1f T C 5: 11,469,071 (GRCm39) V74A possibly damaging Het
Tns2 A G 15: 102,012,914 (GRCm39) M1V probably null Het
Ttn C A 2: 76,725,036 (GRCm39) probably benign Het
Ugt3a1 A T 15: 9,306,240 (GRCm39) M130L probably benign Het
Urb2 C T 8: 124,755,036 (GRCm39) H248Y probably benign Het
Vit A T 17: 78,932,585 (GRCm39) N564I probably damaging Het
Vmn1r60 A T 7: 5,547,310 (GRCm39) Y263* probably null Het
Vmn2r16 A T 5: 109,511,620 (GRCm39) Y609F probably damaging Het
Xpo7 T C 14: 70,908,512 (GRCm39) I876V probably benign Het
Zfp442 A G 2: 150,249,937 (GRCm39) I655T probably benign Het
Zfp574 T A 7: 24,779,622 (GRCm39) C215S possibly damaging Het
Zfp608 T C 18: 55,121,069 (GRCm39) T173A probably benign Het
Zfp69 A T 4: 120,788,598 (GRCm39) V239D possibly damaging Het
Other mutations in Bpifa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Bpifa6 APN 2 153,832,386 (GRCm39) missense probably benign 0.00
IGL01805:Bpifa6 APN 2 153,826,832 (GRCm39) missense probably benign 0.03
IGL02246:Bpifa6 APN 2 153,831,196 (GRCm39) missense probably damaging 0.98
IGL02275:Bpifa6 APN 2 153,834,192 (GRCm39) missense probably benign 0.40
IGL02405:Bpifa6 APN 2 153,832,782 (GRCm39) nonsense probably null
IGL02587:Bpifa6 APN 2 153,831,130 (GRCm39) missense probably damaging 0.99
IGL03365:Bpifa6 APN 2 153,831,204 (GRCm39) missense possibly damaging 0.71
F6893:Bpifa6 UTSW 2 153,829,078 (GRCm39) missense probably damaging 1.00
FR4976:Bpifa6 UTSW 2 153,828,318 (GRCm39) missense probably benign
FR4976:Bpifa6 UTSW 2 153,828,296 (GRCm39) missense probably benign
R0131:Bpifa6 UTSW 2 153,824,851 (GRCm39) missense probably benign 0.11
R0131:Bpifa6 UTSW 2 153,824,851 (GRCm39) missense probably benign 0.11
R0132:Bpifa6 UTSW 2 153,824,851 (GRCm39) missense probably benign 0.11
R0799:Bpifa6 UTSW 2 153,834,192 (GRCm39) missense probably benign 0.40
R1468:Bpifa6 UTSW 2 153,831,192 (GRCm39) missense probably benign 0.01
R1468:Bpifa6 UTSW 2 153,831,192 (GRCm39) missense probably benign 0.01
R1767:Bpifa6 UTSW 2 153,829,147 (GRCm39) missense possibly damaging 0.95
R2255:Bpifa6 UTSW 2 153,832,815 (GRCm39) missense probably damaging 0.98
R2857:Bpifa6 UTSW 2 153,831,194 (GRCm39) missense probably benign 0.03
R3430:Bpifa6 UTSW 2 153,831,171 (GRCm39) missense probably benign 0.00
R4616:Bpifa6 UTSW 2 153,824,908 (GRCm39) missense possibly damaging 0.47
R5420:Bpifa6 UTSW 2 153,831,250 (GRCm39) missense probably damaging 0.98
R6224:Bpifa6 UTSW 2 153,829,073 (GRCm39) missense probably damaging 0.99
R6483:Bpifa6 UTSW 2 153,832,354 (GRCm39) missense probably benign 0.13
R6552:Bpifa6 UTSW 2 153,829,078 (GRCm39) missense probably damaging 0.99
R7378:Bpifa6 UTSW 2 153,828,353 (GRCm39) missense probably damaging 0.99
R7472:Bpifa6 UTSW 2 153,831,249 (GRCm39) missense possibly damaging 0.93
R8313:Bpifa6 UTSW 2 153,831,178 (GRCm39) nonsense probably null
R9193:Bpifa6 UTSW 2 153,826,740 (GRCm39) missense probably benign 0.38
R9309:Bpifa6 UTSW 2 153,834,207 (GRCm39) missense probably benign 0.03
R9316:Bpifa6 UTSW 2 153,828,383 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CAGCAGATAGGGAATGGTCTC -3'
(R):5'- AGTTCATGAGTAAGGGCGTG -3'

Sequencing Primer
(F):5'- TAGACATGCCTGCTTGGGACAG -3'
(R):5'- GGTGCTCAAGGCTGCATG -3'
Posted On 2019-05-13