Incidental Mutation 'R7061:Depdc1a'
ID548248
Institutional Source Beutler Lab
Gene Symbol Depdc1a
Ensembl Gene ENSMUSG00000028175
Gene NameDEP domain containing 1a
Synonyms5830484J08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location159495433-159529955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 159522852 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 414 (S414T)
Ref Sequence ENSEMBL: ENSMUSP00000029825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029825] [ENSMUST00000106041] [ENSMUST00000120272]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029825
AA Change: S414T

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029825
Gene: ENSMUSG00000028175
AA Change: S414T

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
low complexity region 505 524 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
SCOP:d1f7ca_ 584 680 3e-9 SMART
low complexity region 745 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106041
SMART Domains Protein: ENSMUSP00000101656
Gene: ENSMUSG00000028175

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
Pfam:RhoGAP 251 357 2.3e-11 PFAM
coiled coil region 460 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120272
AA Change: S414T

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113216
Gene: ENSMUSG00000028175
AA Change: S414T

DomainStartEndE-ValueType
DEP 24 108 3.51e-24 SMART
low complexity region 505 524 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
SCOP:d1f7ca_ 584 680 4e-9 SMART
coiled coil region 737 765 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Depdc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Depdc1a APN 3 159522738 nonsense probably null
IGL00581:Depdc1a APN 3 159526552 missense probably benign 0.12
IGL00961:Depdc1a APN 3 159523814 missense possibly damaging 0.79
IGL01530:Depdc1a APN 3 159523923 missense probably damaging 1.00
IGL01567:Depdc1a APN 3 159526546 missense probably damaging 1.00
IGL02320:Depdc1a APN 3 159516933 missense probably damaging 0.99
IGL02622:Depdc1a APN 3 159515510 missense probably benign 0.02
IGL02647:Depdc1a APN 3 159522866 missense probably damaging 1.00
P0033:Depdc1a UTSW 3 159516141 missense probably damaging 0.99
P4717OSA:Depdc1a UTSW 3 159522547 missense probably damaging 1.00
P4748:Depdc1a UTSW 3 159522547 missense probably damaging 1.00
R0220:Depdc1a UTSW 3 159523905 missense probably benign 0.06
R0454:Depdc1a UTSW 3 159516900 splice site probably null
R0479:Depdc1a UTSW 3 159520860 missense probably damaging 1.00
R1317:Depdc1a UTSW 3 159523287 missense probably damaging 1.00
R1452:Depdc1a UTSW 3 159526691 missense possibly damaging 0.88
R1567:Depdc1a UTSW 3 159522540 missense possibly damaging 0.86
R1669:Depdc1a UTSW 3 159522924 missense probably benign 0.07
R1751:Depdc1a UTSW 3 159523287 missense probably damaging 1.00
R2332:Depdc1a UTSW 3 159523866 missense probably damaging 1.00
R4023:Depdc1a UTSW 3 159516149 splice site probably null
R4254:Depdc1a UTSW 3 159498487 missense probably damaging 0.99
R4551:Depdc1a UTSW 3 159522584 missense probably damaging 1.00
R4780:Depdc1a UTSW 3 159526706 missense probably benign 0.00
R4782:Depdc1a UTSW 3 159526636 missense probably damaging 1.00
R4866:Depdc1a UTSW 3 159516127 missense probably damaging 0.96
R4981:Depdc1a UTSW 3 159523913 missense probably benign 0.14
R5100:Depdc1a UTSW 3 159515520 missense probably benign 0.06
R5326:Depdc1a UTSW 3 159526649 missense probably damaging 1.00
R5367:Depdc1a UTSW 3 159523954 splice site probably null
R5892:Depdc1a UTSW 3 159526669 missense probably damaging 1.00
R6314:Depdc1a UTSW 3 159498414 missense probably damaging 1.00
R6467:Depdc1a UTSW 3 159516042 missense probably benign 0.00
R6674:Depdc1a UTSW 3 159526707 missense probably benign 0.00
R7366:Depdc1a UTSW 3 159523212 missense probably benign 0.00
R7531:Depdc1a UTSW 3 159522639 missense probably damaging 1.00
R7886:Depdc1a UTSW 3 159516069 missense probably benign 0.04
R7981:Depdc1a UTSW 3 159520851 missense probably benign 0.00
R8335:Depdc1a UTSW 3 159523222 missense probably damaging 1.00
R8488:Depdc1a UTSW 3 159523875 missense probably damaging 0.96
R8560:Depdc1a UTSW 3 159514275 missense probably damaging 1.00
R8725:Depdc1a UTSW 3 159522719 missense probably benign 0.03
R8727:Depdc1a UTSW 3 159522719 missense probably benign 0.03
X0026:Depdc1a UTSW 3 159498631 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTGAGTGTCTTCTTCTCAGTCTG -3'
(R):5'- GCTGCTGAGCATTTTCATCTG -3'

Sequencing Primer
(F):5'- GTCTGCTTTACAAAGACAAAAGC -3'
(R):5'- CTGAGCATTTTCATCTGAGTGAAG -3'
Posted On2019-05-13