Incidental Mutation 'R7061:Slc6a9'
ID548250
Institutional Source Beutler Lab
Gene Symbol Slc6a9
Ensembl Gene ENSMUSG00000028542
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 9
SynonymsGlyt1, Glyt-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117834506-117875198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117868064 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 575 (T575I)
Ref Sequence ENSEMBL: ENSMUSP00000066102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030269] [ENSMUST00000063857] [ENSMUST00000084325] [ENSMUST00000106422] [ENSMUST00000131938] [ENSMUST00000132043] [ENSMUST00000149168] [ENSMUST00000163288] [ENSMUST00000164853] [ENSMUST00000166325] [ENSMUST00000167287] [ENSMUST00000167443] [ENSMUST00000169885] [ENSMUST00000169990] [ENSMUST00000171052]
Predicted Effect probably benign
Transcript: ENSMUST00000030269
AA Change: T575I

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030269
Gene: ENSMUSG00000028542
AA Change: T575I

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063857
AA Change: T575I

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066102
Gene: ENSMUSG00000028542
AA Change: T575I

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084325
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106422
SMART Domains Protein: ENSMUSP00000102030
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131938
Predicted Effect probably benign
Transcript: ENSMUST00000132043
SMART Domains Protein: ENSMUSP00000122676
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 32 321 1.4e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149168
SMART Domains Protein: ENSMUSP00000129359
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
low complexity region 91 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163288
AA Change: T579I

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127289
Gene: ENSMUSG00000028542
AA Change: T579I

DomainStartEndE-ValueType
Pfam:SNF 46 566 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164853
SMART Domains Protein: ENSMUSP00000132114
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166325
SMART Domains Protein: ENSMUSP00000131493
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 33 57 N/A INTRINSIC
low complexity region 61 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167287
SMART Domains Protein: ENSMUSP00000126161
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 13 38 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167443
SMART Domains Protein: ENSMUSP00000128771
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 188 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169885
AA Change: T463I

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127093
Gene: ENSMUSG00000028542
AA Change: T463I

DomainStartEndE-ValueType
Pfam:SNF 1 450 1.2e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169990
SMART Domains Protein: ENSMUSP00000127203
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 84 373 2.3e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171052
SMART Domains Protein: ENSMUSP00000129502
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
Pfam:CCDC24 21 201 3.9e-67 PFAM
low complexity region 282 294 N/A INTRINSIC
Meta Mutation Damage Score 0.1021 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The amino acid glycine acts as an inhibitory neurotransmitter in the central nervous system. The protein encoded by this gene is one of two transporters that stop glycine signaling by removing it from the synaptic cleft. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice die shortly after birth exhibiting breathing and movement deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Slc6a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Slc6a9 APN 4 117864617 missense probably damaging 1.00
IGL01728:Slc6a9 APN 4 117864605 missense probably damaging 1.00
IGL02111:Slc6a9 APN 4 117864013 missense probably benign 0.19
R0051:Slc6a9 UTSW 4 117864859 missense probably damaging 1.00
R0051:Slc6a9 UTSW 4 117864859 missense probably damaging 1.00
R1170:Slc6a9 UTSW 4 117864806 missense possibly damaging 0.77
R2872:Slc6a9 UTSW 4 117849381 start codon destroyed probably null 0.02
R2872:Slc6a9 UTSW 4 117849381 start codon destroyed probably null 0.02
R3499:Slc6a9 UTSW 4 117856803 missense probably benign 0.01
R4744:Slc6a9 UTSW 4 117867895 missense probably benign 0.00
R4970:Slc6a9 UTSW 4 117856008 missense probably damaging 1.00
R5055:Slc6a9 UTSW 4 117868150 splice site probably null
R5103:Slc6a9 UTSW 4 117868155 missense probably benign
R5726:Slc6a9 UTSW 4 117864013 missense probably damaging 1.00
R6836:Slc6a9 UTSW 4 117867886 missense possibly damaging 0.49
R7030:Slc6a9 UTSW 4 117857436 missense possibly damaging 0.94
R7278:Slc6a9 UTSW 4 117868106 missense probably benign 0.31
R7863:Slc6a9 UTSW 4 117864010 missense probably damaging 1.00
R8036:Slc6a9 UTSW 4 117867886 missense possibly damaging 0.49
Z1176:Slc6a9 UTSW 4 117857366 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGATCCAGTACCGGCCAATC -3'
(R):5'- ACAATTGCGCTCATATCCGG -3'

Sequencing Primer
(F):5'- ACTGTACGCGCTGTTCCAG -3'
(R):5'- AATTGCGCTCATATCCGGGAGTC -3'
Posted On2019-05-13