Incidental Mutation 'R7061:Olfr1350'
ID548261
Institutional Source Beutler Lab
Gene Symbol Olfr1350
Ensembl Gene ENSMUSG00000056696
Gene Nameolfactory receptor 1350
SynonymsGA_x6K02T2QGBW-3300391-3301317, MOR222-3
MMRRC Submission
Accession Numbers

Genbank: NM_146389.1

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location6564841-6571401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6570783 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 264 (Y264C)
Ref Sequence ENSEMBL: ENSMUSP00000151318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070985] [ENSMUST00000207221] [ENSMUST00000219278]
Predicted Effect probably damaging
Transcript: ENSMUST00000070985
AA Change: Y264C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069927
Gene: ENSMUSG00000056696
AA Change: Y264C

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.6e-50 PFAM
Pfam:7tm_1 39 288 8.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207221
AA Change: Y264C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219278
AA Change: Y264C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Olfr1350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Olfr1350 APN 7 6570668 missense possibly damaging 0.88
IGL01387:Olfr1350 APN 7 6570855 missense probably damaging 1.00
IGL01457:Olfr1350 APN 7 6570212 missense probably benign 0.12
IGL01568:Olfr1350 APN 7 6570570 missense possibly damaging 0.91
I2288:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
I2289:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
R0454:Olfr1350 UTSW 7 6570360 missense probably damaging 1.00
R0558:Olfr1350 UTSW 7 6570653 missense possibly damaging 0.77
R1103:Olfr1350 UTSW 7 6570112 missense probably damaging 1.00
R1352:Olfr1350 UTSW 7 6570783 missense probably benign 0.11
R1503:Olfr1350 UTSW 7 6570471 missense probably damaging 1.00
R1630:Olfr1350 UTSW 7 6570674 missense probably damaging 1.00
R1981:Olfr1350 UTSW 7 6570558 missense probably benign 0.01
R2228:Olfr1350 UTSW 7 6570803 missense probably benign
R2258:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R2259:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R2260:Olfr1350 UTSW 7 6570023 missense probably damaging 0.98
R4075:Olfr1350 UTSW 7 6570143 missense probably benign 0.00
R4750:Olfr1350 UTSW 7 6570851 missense probably benign 0.34
R4917:Olfr1350 UTSW 7 6570644 missense possibly damaging 0.88
R4918:Olfr1350 UTSW 7 6570644 missense possibly damaging 0.88
R5571:Olfr1350 UTSW 7 6570825 missense possibly damaging 0.95
R5915:Olfr1350 UTSW 7 6570173 missense probably benign 0.31
R6969:Olfr1350 UTSW 7 6570321 missense probably damaging 1.00
R7286:Olfr1350 UTSW 7 6570716 missense probably damaging 1.00
R7510:Olfr1350 UTSW 7 6569961 start gained probably benign
V1662:Olfr1350 UTSW 7 6570819 missense probably damaging 1.00
Z1176:Olfr1350 UTSW 7 6570048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCATCTAGCTTGTGGTGAC -3'
(R):5'- CTGGTTTCTGGAACTTCCCG -3'

Sequencing Primer
(F):5'- GTGACACCCAAGGCCATGAG -3'
(R):5'- GAACTTCCCGTGTCTAAGTGTCAG -3'
Posted On2019-05-13