Mutagenetix > Incidental Mutation

Incidental Mutation 'R7061:Ap3b2'

548264

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R7061 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 81461009 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1006 (R1006Q)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090]

AlphaFold

Q9JME5

Predicted Effect

unknown
Transcript: ENSMUST00000082090
AA Change: R1006Q

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: R1006Q

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,545,065	M660T	probably benign	Het
Aard	G	A	15: 52,040,221	M13I	probably benign	Het
Abcb5	A	C	12: 118,877,774	Y979D	probably damaging	Het
Adgrb1	G	C	15: 74,569,881	V4L	probably benign	Het
Bpifa6	A	T	2: 153,992,316	T343S	probably benign	Het
Celsr3	T	A	9: 108,847,594	C2957*	probably null	Het
Chd6	G	A	2: 161,025,965	Q428*	probably null	Het
Col5a1	C	A	2: 28,025,678	C191*	probably null	Het
Cpox	A	G	16: 58,670,860	I145V	possibly damaging	Het
Csnk2a1	C	T	2: 152,274,171	R268C	probably benign	Het
Dclk2	A	G	3: 86,831,731		probably null	Het
Dennd5a	T	C	7: 109,905,179	E909G	probably benign	Het
Depdc1a	T	A	3: 159,522,852	S414T	possibly damaging	Het
Dock5	A	G	14: 67,770,254	F1502S	probably damaging	Het
Dopey2	G	T	16: 93,762,063	A448S	probably benign	Het
Dsg1c	C	A	18: 20,277,009	N511K	probably benign	Het
Epc2	G	T	2: 49,535,322	R108L	probably damaging	Het
Erp44	T	A	4: 48,219,375	I147F	probably benign	Het
Evc	T	C	5: 37,319,102	T368A	possibly damaging	Het
Fbxo41	G	T	6: 85,475,466	R738S	probably benign	Het
Fli1	T	C	9: 32,424,222	T305A	probably damaging	Het
Gm4969	A	T	7: 19,100,128		probably benign	Het
Gm8897	T	C	5: 11,419,104	V74A	possibly damaging	Het
Grk5	A	G	19: 61,046,092	T93A	probably benign	Het
Grm2	A	T	9: 106,651,225	N153K	probably damaging	Het
Helz	A	G	11: 107,649,177	T1007A	possibly damaging	Het
Helz2	A	G	2: 181,240,514	L162P	probably damaging	Het
Hmgcr	T	A	13: 96,666,148	Q81L	possibly damaging	Het
Hnrnpu	T	C	1: 178,336,126	K218E	unknown	Het
Hydin	A	T	8: 110,603,288	I4885F	possibly damaging	Het
Ibsp	A	G	5: 104,309,902		probably null	Het
Igfals	T	C	17: 24,880,307	L124P	probably damaging	Het
Il24	T	A	1: 130,883,371	H142L	possibly damaging	Het
Kcnh2	A	T	5: 24,331,922	H221Q	probably benign	Het
Man1a	A	G	10: 53,920,235	S454P	probably damaging	Het
Mfsd4b1	C	T	10: 40,003,386	V172M	possibly damaging	Het
Mical2	T	A	7: 112,346,801	I763K	probably benign	Het
Mybpc3	A	G	2: 91,125,404	I594M	possibly damaging	Het
Neo1	T	A	9: 58,990,441	R77S	possibly damaging	Het
Nlrp6	A	G	7: 140,922,867	I265M	probably benign	Het
Olfr1350	A	G	7: 6,570,783	Y264C	probably damaging	Het
Olfr669	T	C	7: 104,938,676	L50P	probably damaging	Het
Olfr877	T	A	9: 37,855,646	V276D	possibly damaging	Het
Pcdhgb5	C	A	18: 37,731,923	P257Q	probably benign	Het
Phactr1	A	G	13: 43,132,981	D586G	probably damaging	Het
Pkn3	T	A	2: 30,083,536		probably null	Het
Prob1	A	T	18: 35,654,500	S234T	probably benign	Het
Rab14	A	T	2: 35,183,417	L131*	probably null	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rhebl1	A	G	15: 98,879,283	L103P	probably damaging	Het
Rnf10	G	T	5: 115,257,090	F146L	probably damaging	Het
Rrbp1	T	C	2: 143,989,167	K360R	possibly damaging	Het
Slc6a9	C	T	4: 117,868,064	T575I	probably benign	Het
Smo	A	G	6: 29,760,230	H776R	probably damaging	Het
Tns2	A	G	15: 102,104,479	M1V	probably null	Het
Ttn	C	A	2: 76,894,692		probably benign	Het
Ugt3a1	A	T	15: 9,306,154	M130L	probably benign	Het
Urb2	C	T	8: 124,028,297	H248Y	probably benign	Het
Vit	A	T	17: 78,625,156	N564I	probably damaging	Het
Vmn1r60	A	T	7: 5,544,311	Y263*	probably null	Het
Vmn2r16	A	T	5: 109,363,754	Y609F	probably damaging	Het
Xpo7	T	C	14: 70,671,072	I876V	probably benign	Het
Zfp442	A	G	2: 150,408,017	I655T	probably benign	Het
Zfp574	T	A	7: 25,080,197	C215S	possibly damaging	Het
Zfp608	T	C	18: 54,987,997	T173A	probably benign	Het
Zfp69	A	T	4: 120,931,401	V239D	possibly damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81473035	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81463798	missense	unknown
R9304:Ap3b2	UTSW	7	81463271	missense	unknown
R9321:Ap3b2	UTSW	7	81464504	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81478009	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81473903	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81476344	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCAGACTCCCACTAGTTAATGTCC -3'
(R):5'- TAGTGACCTGCAGAGCCTTG -3'

Sequencing Primer
(F):5'- TCCCTGCAAACCTAAGATGGGAG -3'
(R):5'- CTGCAGAGCCTTGGAGAACTG -3'

Posted On

2019-05-13