Incidental Mutation 'R7061:Ap3b2'
ID 548264
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms Naptb, beta3B
MMRRC Submission 045384-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R7061 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 81110147-81143673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 81110757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1006 (R1006Q)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090]
AlphaFold Q9JME5
Predicted Effect unknown
Transcript: ENSMUST00000082090
AA Change: R1006Q
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: R1006Q

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard G A 15: 51,903,617 (GRCm39) M13I probably benign Het
Abcb5 A C 12: 118,841,509 (GRCm39) Y979D probably damaging Het
Adgrb1 G C 15: 74,441,730 (GRCm39) V4L probably benign Het
Bpifa6 A T 2: 153,834,236 (GRCm39) T343S probably benign Het
Celsr3 T A 9: 108,724,793 (GRCm39) C2957* probably null Het
Chd6 G A 2: 160,867,885 (GRCm39) Q428* probably null Het
Col5a1 C A 2: 27,915,690 (GRCm39) C191* probably null Het
Cpox A G 16: 58,491,223 (GRCm39) I145V possibly damaging Het
Csnk2a1 C T 2: 152,116,091 (GRCm39) R268C probably benign Het
Dclk2 A G 3: 86,739,038 (GRCm39) probably null Het
Dennd5a T C 7: 109,504,386 (GRCm39) E909G probably benign Het
Depdc1a T A 3: 159,228,489 (GRCm39) S414T possibly damaging Het
Dock5 A G 14: 68,007,703 (GRCm39) F1502S probably damaging Het
Dop1b G T 16: 93,558,951 (GRCm39) A448S probably benign Het
Dsg1c C A 18: 20,410,066 (GRCm39) N511K probably benign Het
Epc2 G T 2: 49,425,334 (GRCm39) R108L probably damaging Het
Erp44 T A 4: 48,219,375 (GRCm39) I147F probably benign Het
Evc T C 5: 37,476,446 (GRCm39) T368A possibly damaging Het
Fbxo41 G T 6: 85,452,448 (GRCm39) R738S probably benign Het
Fli1 T C 9: 32,335,518 (GRCm39) T305A probably damaging Het
Grk5 A G 19: 61,034,530 (GRCm39) T93A probably benign Het
Grm2 A T 9: 106,528,424 (GRCm39) N153K probably damaging Het
Helz A G 11: 107,540,003 (GRCm39) T1007A possibly damaging Het
Helz2 A G 2: 180,882,307 (GRCm39) L162P probably damaging Het
Hmgcr T A 13: 96,802,656 (GRCm39) Q81L possibly damaging Het
Hnrnpu T C 1: 178,163,691 (GRCm39) K218E unknown Het
Hydin A T 8: 111,329,920 (GRCm39) I4885F possibly damaging Het
Ibsp A G 5: 104,457,768 (GRCm39) probably null Het
Igfals T C 17: 25,099,281 (GRCm39) L124P probably damaging Het
Il24 T A 1: 130,811,108 (GRCm39) H142L possibly damaging Het
Iqca1l A G 5: 24,750,063 (GRCm39) M660T probably benign Het
Kcnh2 A T 5: 24,536,920 (GRCm39) H221Q probably benign Het
Man1a A G 10: 53,796,331 (GRCm39) S454P probably damaging Het
Meiosin A T 7: 18,834,053 (GRCm39) probably benign Het
Mfsd4b1 C T 10: 39,879,382 (GRCm39) V172M possibly damaging Het
Mical2 T A 7: 111,946,008 (GRCm39) I763K probably benign Het
Mybpc3 A G 2: 90,955,749 (GRCm39) I594M possibly damaging Het
Neo1 T A 9: 58,897,724 (GRCm39) R77S possibly damaging Het
Nlrp6 A G 7: 140,502,780 (GRCm39) I265M probably benign Het
Or52n5 T C 7: 104,587,883 (GRCm39) L50P probably damaging Het
Or5bw2 A G 7: 6,573,782 (GRCm39) Y264C probably damaging Het
Or8b9 T A 9: 37,766,942 (GRCm39) V276D possibly damaging Het
Pcdhgb5 C A 18: 37,864,976 (GRCm39) P257Q probably benign Het
Phactr1 A G 13: 43,286,457 (GRCm39) D586G probably damaging Het
Pkn3 T A 2: 29,973,548 (GRCm39) probably null Het
Prob1 A T 18: 35,787,553 (GRCm39) S234T probably benign Het
Rab14 A T 2: 35,073,429 (GRCm39) L131* probably null Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rhebl1 A G 15: 98,777,164 (GRCm39) L103P probably damaging Het
Rnf10 G T 5: 115,395,149 (GRCm39) F146L probably damaging Het
Rrbp1 T C 2: 143,831,087 (GRCm39) K360R possibly damaging Het
Slc6a9 C T 4: 117,725,261 (GRCm39) T575I probably benign Het
Smo A G 6: 29,760,229 (GRCm39) H776R probably damaging Het
Speer1f T C 5: 11,469,071 (GRCm39) V74A possibly damaging Het
Tns2 A G 15: 102,012,914 (GRCm39) M1V probably null Het
Ttn C A 2: 76,725,036 (GRCm39) probably benign Het
Ugt3a1 A T 15: 9,306,240 (GRCm39) M130L probably benign Het
Urb2 C T 8: 124,755,036 (GRCm39) H248Y probably benign Het
Vit A T 17: 78,932,585 (GRCm39) N564I probably damaging Het
Vmn1r60 A T 7: 5,547,310 (GRCm39) Y263* probably null Het
Vmn2r16 A T 5: 109,511,620 (GRCm39) Y609F probably damaging Het
Xpo7 T C 14: 70,908,512 (GRCm39) I876V probably benign Het
Zfp442 A G 2: 150,249,937 (GRCm39) I655T probably benign Het
Zfp574 T A 7: 24,779,622 (GRCm39) C215S possibly damaging Het
Zfp608 T C 18: 55,121,069 (GRCm39) T173A probably benign Het
Zfp69 A T 4: 120,788,598 (GRCm39) V239D possibly damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81,121,697 (GRCm39) missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81,126,687 (GRCm39) splice site probably benign
IGL01876:Ap3b2 APN 7 81,123,602 (GRCm39) splice site probably null
IGL02132:Ap3b2 APN 7 81,110,746 (GRCm39) missense unknown
IGL02227:Ap3b2 APN 7 81,123,152 (GRCm39) missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81,115,446 (GRCm39) missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81,122,828 (GRCm39) missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81,113,429 (GRCm39) splice site probably null
R0568:Ap3b2 UTSW 7 81,114,377 (GRCm39) critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81,113,659 (GRCm39) missense unknown
R1121:Ap3b2 UTSW 7 81,113,943 (GRCm39) missense unknown
R1160:Ap3b2 UTSW 7 81,115,917 (GRCm39) critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81,113,438 (GRCm39) nonsense probably null
R1542:Ap3b2 UTSW 7 81,127,825 (GRCm39) splice site probably null
R1652:Ap3b2 UTSW 7 81,123,147 (GRCm39) missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81,117,347 (GRCm39) missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81,113,898 (GRCm39) missense unknown
R2065:Ap3b2 UTSW 7 81,113,522 (GRCm39) missense unknown
R2353:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2354:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2398:Ap3b2 UTSW 7 81,126,943 (GRCm39) missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3710:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3932:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3933:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R4152:Ap3b2 UTSW 7 81,127,765 (GRCm39) missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81,126,884 (GRCm39) missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81,127,678 (GRCm39) missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81,126,517 (GRCm39) missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81,126,500 (GRCm39) missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81,143,340 (GRCm39) missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81,123,210 (GRCm39) nonsense probably null
R6901:Ap3b2 UTSW 7 81,134,660 (GRCm39) critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81,127,741 (GRCm39) missense probably damaging 1.00
R7317:Ap3b2 UTSW 7 81,110,776 (GRCm39) missense unknown
R7501:Ap3b2 UTSW 7 81,123,194 (GRCm39) missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81,115,894 (GRCm39) splice site probably null
R7643:Ap3b2 UTSW 7 81,126,820 (GRCm39) missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81,126,530 (GRCm39) missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81,113,530 (GRCm39) missense unknown
R8273:Ap3b2 UTSW 7 81,112,990 (GRCm39) missense unknown
R8325:Ap3b2 UTSW 7 81,134,237 (GRCm39) splice site probably null
R8355:Ap3b2 UTSW 7 81,122,851 (GRCm39) missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81,122,783 (GRCm39) missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81,126,901 (GRCm39) missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81,126,931 (GRCm39) missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81,117,192 (GRCm39) missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81,113,546 (GRCm39) missense unknown
R9304:Ap3b2 UTSW 7 81,113,019 (GRCm39) missense unknown
R9321:Ap3b2 UTSW 7 81,114,252 (GRCm39) critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81,127,757 (GRCm39) missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81,123,651 (GRCm39) missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81,126,092 (GRCm39) missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81,112,988 (GRCm39) critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81,113,512 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGACTCCCACTAGTTAATGTCC -3'
(R):5'- TAGTGACCTGCAGAGCCTTG -3'

Sequencing Primer
(F):5'- TCCCTGCAAACCTAAGATGGGAG -3'
(R):5'- CTGCAGAGCCTTGGAGAACTG -3'
Posted On 2019-05-13