Incidental Mutation 'R7061:Olfr669'
ID548265
Institutional Source Beutler Lab
Gene Symbol Olfr669
Ensembl Gene ENSMUSG00000073916
Gene Nameolfactory receptor 669
SynonymsMOR34-6, GA_x6K02T2PBJ9-7567376-7568329
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104934240-104940477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104938676 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 50 (L50P)
Ref Sequence ENSEMBL: ENSMUSP00000150928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098164] [ENSMUST00000210138] [ENSMUST00000214260]
Predicted Effect probably damaging
Transcript: ENSMUST00000098164
AA Change: L50P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095767
Gene: ENSMUSG00000073916
AA Change: L50P

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 8.7e-103 PFAM
Pfam:7TM_GPCR_Srsx 37 209 1.9e-10 PFAM
Pfam:7tm_1 43 295 2.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210138
AA Change: L50P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214260
AA Change: L50P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Olfr669
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr669 APN 7 104938991 missense possibly damaging 0.88
IGL01677:Olfr669 APN 7 104938645 missense probably benign 0.01
IGL01900:Olfr669 APN 7 104939162 missense probably damaging 1.00
IGL02270:Olfr669 APN 7 104939369 missense possibly damaging 0.95
R0482:Olfr669 UTSW 7 104938814 missense possibly damaging 0.56
R0970:Olfr669 UTSW 7 104939077 missense probably benign 0.05
R4260:Olfr669 UTSW 7 104938596 missense probably damaging 0.99
R4845:Olfr669 UTSW 7 104939363 missense possibly damaging 0.95
R4947:Olfr669 UTSW 7 104938742 missense possibly damaging 0.95
R5438:Olfr669 UTSW 7 104939137 missense probably benign 0.03
R5735:Olfr669 UTSW 7 104938759 missense probably benign 0.01
R5943:Olfr669 UTSW 7 104938643 missense possibly damaging 0.78
R6435:Olfr669 UTSW 7 104938834 missense probably damaging 0.99
R6942:Olfr669 UTSW 7 104938897 missense possibly damaging 0.56
R7122:Olfr669 UTSW 7 104939198 missense probably damaging 0.99
R7378:Olfr669 UTSW 7 104939431 missense probably benign 0.31
R7898:Olfr669 UTSW 7 104939366 missense probably damaging 1.00
R8260:Olfr669 UTSW 7 104938672 missense probably damaging 1.00
R8478:Olfr669 UTSW 7 104939270 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGATAGAGTCTTCTGGAACAATAG -3'
(R):5'- TGAGCATGAGTACCCCAGAC -3'

Sequencing Primer
(F):5'- CTTCTGGAACAATAGTGTGTGTC -3'
(R):5'- CTGTGAATCCGTGCACAAAG -3'
Posted On2019-05-13