Incidental Mutation 'R7061:Urb2'
ID548270
Institutional Source Beutler Lab
Gene Symbol Urb2
Ensembl Gene ENSMUSG00000031976
Gene NameURB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124021508-124048505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124028297 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 248 (H248Y)
Ref Sequence ENSEMBL: ENSMUSP00000133547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034457] [ENSMUST00000127664] [ENSMUST00000173168]
Predicted Effect probably benign
Transcript: ENSMUST00000034457
AA Change: H248Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034457
Gene: ENSMUSG00000031976
AA Change: H248Y

DomainStartEndE-ValueType
low complexity region 489 503 N/A INTRINSIC
low complexity region 541 546 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
low complexity region 1073 1092 N/A INTRINSIC
low complexity region 1172 1188 N/A INTRINSIC
low complexity region 1273 1279 N/A INTRINSIC
Pfam:Urb2 1319 1515 2.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173168
AA Change: H248Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133547
Gene: ENSMUSG00000031976
AA Change: H248Y

DomainStartEndE-ValueType
low complexity region 489 503 N/A INTRINSIC
low complexity region 541 546 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
low complexity region 1073 1092 N/A INTRINSIC
low complexity region 1172 1188 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Urb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Urb2 APN 8 124028694 missense probably damaging 1.00
IGL00705:Urb2 APN 8 124036637 missense probably benign 0.00
IGL02090:Urb2 APN 8 124028237 missense probably benign 0.28
IGL02707:Urb2 APN 8 124030686 missense probably benign 0.04
IGL03103:Urb2 APN 8 124029752 missense probably benign 0.17
IGL03402:Urb2 APN 8 124029849 missense possibly damaging 0.92
R0037:Urb2 UTSW 8 124047195 missense probably damaging 1.00
R0113:Urb2 UTSW 8 124030926 missense probably benign 0.00
R0883:Urb2 UTSW 8 124030970 nonsense probably null
R1015:Urb2 UTSW 8 124029434 missense probably damaging 1.00
R1265:Urb2 UTSW 8 124025153 missense probably damaging 1.00
R1463:Urb2 UTSW 8 124030908 missense probably benign 0.04
R1497:Urb2 UTSW 8 124028077 missense probably damaging 1.00
R1556:Urb2 UTSW 8 124030617 missense probably damaging 1.00
R1622:Urb2 UTSW 8 124029624 missense probably benign
R1914:Urb2 UTSW 8 124029798 missense possibly damaging 0.81
R1915:Urb2 UTSW 8 124029798 missense possibly damaging 0.81
R2172:Urb2 UTSW 8 124031102 missense probably damaging 1.00
R2240:Urb2 UTSW 8 124030139 missense probably benign 0.02
R2424:Urb2 UTSW 8 124030426 missense probably benign 0.02
R4085:Urb2 UTSW 8 124030941 missense probably benign 0.02
R4119:Urb2 UTSW 8 124047240 missense probably benign 0.00
R4732:Urb2 UTSW 8 124028897 missense probably damaging 1.00
R4733:Urb2 UTSW 8 124028897 missense probably damaging 1.00
R4865:Urb2 UTSW 8 124029635 nonsense probably null
R5005:Urb2 UTSW 8 124031181 missense probably damaging 0.97
R5381:Urb2 UTSW 8 124029912 missense probably benign 0.02
R5704:Urb2 UTSW 8 124038182 missense probably damaging 0.97
R5891:Urb2 UTSW 8 124030856 missense possibly damaging 0.64
R5958:Urb2 UTSW 8 124029659 missense probably benign 0.01
R5966:Urb2 UTSW 8 124028088 missense probably benign 0.00
R6133:Urb2 UTSW 8 124028561 nonsense probably null
R6136:Urb2 UTSW 8 124030092 missense probably benign
R6341:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6343:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6344:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6417:Urb2 UTSW 8 124047199 missense probably damaging 1.00
R6420:Urb2 UTSW 8 124047199 missense probably damaging 1.00
R6585:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6586:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6587:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6588:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R7090:Urb2 UTSW 8 124030599 missense probably benign
R7371:Urb2 UTSW 8 124028269 missense probably benign 0.00
R7467:Urb2 UTSW 8 124028511 missense probably benign
R7542:Urb2 UTSW 8 124028588 missense probably benign
R7545:Urb2 UTSW 8 124029752 missense probably benign 0.00
R7686:Urb2 UTSW 8 124045172 missense probably benign 0.01
X0020:Urb2 UTSW 8 124030983 missense possibly damaging 0.91
X0027:Urb2 UTSW 8 124028814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTAAGCGTGTCTTTGG -3'
(R):5'- ACTGGCTTTCTTCCTGAAGG -3'

Sequencing Primer
(F):5'- GGAGATATGACTGGACACCTCTTTC -3'
(R):5'- CTTCCTGAAGGTATGCTTCCAGAAAG -3'
Posted On2019-05-13