Incidental Mutation 'R7061:Fli1'
ID548271
Institutional Source Beutler Lab
Gene Symbol Fli1
Ensembl Gene ENSMUSG00000016087
Gene NameFriend leukemia integration 1
SynonymsSIC-1, EWSR2, Sic1, Fli-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location32422204-32542861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32424222 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 305 (T305A)
Ref Sequence ENSEMBL: ENSMUSP00000016231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016231] [ENSMUST00000183767]
Predicted Effect probably damaging
Transcript: ENSMUST00000016231
AA Change: T305A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016231
Gene: ENSMUSG00000016087
AA Change: T305A

DomainStartEndE-ValueType
SAM_PNT 114 198 2.52e-38 SMART
ETS 280 365 1.22e-57 SMART
low complexity region 402 414 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183767
SMART Domains Protein: ENSMUSP00000138984
Gene: ENSMUSG00000016087

DomainStartEndE-ValueType
SAM_PNT 81 165 2.52e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for most knock-out allele exhibit abnormal hematopoietic and immune systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Fli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Fli1 APN 9 32423940 missense probably benign 0.31
IGL01329:Fli1 APN 9 32424101 missense probably damaging 1.00
IGL01925:Fli1 APN 9 32465831 missense probably damaging 1.00
IGL01951:Fli1 APN 9 32461364 missense probably damaging 0.99
IGL01963:Fli1 APN 9 32424207 nonsense probably null
IGL02889:Fli1 APN 9 32465696 missense probably damaging 1.00
R0026:Fli1 UTSW 9 32476584 missense probably damaging 1.00
R0243:Fli1 UTSW 9 32423981 missense probably benign 0.00
R0279:Fli1 UTSW 9 32461427 missense probably damaging 1.00
R0418:Fli1 UTSW 9 32452129 splice site probably benign
R0967:Fli1 UTSW 9 32461449 missense probably benign
R1228:Fli1 UTSW 9 32423843 missense probably damaging 1.00
R1557:Fli1 UTSW 9 32461244 splice site probably benign
R1875:Fli1 UTSW 9 32423913 missense probably benign 0.03
R3401:Fli1 UTSW 9 32461274 missense probably damaging 1.00
R3898:Fli1 UTSW 9 32476722 missense possibly damaging 0.88
R4051:Fli1 UTSW 9 32452162 missense probably benign 0.03
R6440:Fli1 UTSW 9 32423901 missense probably benign 0.07
R6901:Fli1 UTSW 9 32429925 missense probably benign 0.14
R7231:Fli1 UTSW 9 32424188 missense probably damaging 1.00
R7676:Fli1 UTSW 9 32428030 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GAAGTCAAACTTGTAGGCATACC -3'
(R):5'- AAAGGGTTGTCTCCACTTTCC -3'

Sequencing Primer
(F):5'- GGCATACCTTTTGCCATGCAC -3'
(R):5'- TCAAAGGTATGTGCCACCATG -3'
Posted On2019-05-13