Incidental Mutation 'R7061:Olfr877'
ID548272
Institutional Source Beutler Lab
Gene Symbol Olfr877
Ensembl Gene ENSMUSG00000066749
Gene Nameolfactory receptor 877
SynonymsGA_x6K02T2PVTD-31540342-31541277, MOR161-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37854269-37857320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37855646 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 276 (V276D)
Ref Sequence ENSEMBL: ENSMUSP00000150698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086063] [ENSMUST00000213956]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086063
AA Change: V276D

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083230
Gene: ENSMUSG00000066749
AA Change: V276D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-49 PFAM
Pfam:7tm_1 41 291 6.5e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213956
AA Change: V276D

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Olfr877
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Olfr877 APN 9 37855181 missense probably damaging 1.00
IGL02108:Olfr877 APN 9 37854938 missense possibly damaging 0.88
IGL02474:Olfr877 APN 9 37855360 missense probably benign 0.08
R0006:Olfr877 UTSW 9 37855220 missense possibly damaging 0.95
R0893:Olfr877 UTSW 9 37855196 missense probably damaging 1.00
R1051:Olfr877 UTSW 9 37855361 missense probably damaging 0.99
R1432:Olfr877 UTSW 9 37855252 missense possibly damaging 0.79
R1718:Olfr877 UTSW 9 37855453 missense probably benign 0.03
R1864:Olfr877 UTSW 9 37855264 missense probably damaging 1.00
R4120:Olfr877 UTSW 9 37855409 missense possibly damaging 0.66
R4507:Olfr877 UTSW 9 37854905 missense possibly damaging 0.90
R4900:Olfr877 UTSW 9 37855312 missense probably benign
R5406:Olfr877 UTSW 9 37855219 missense probably benign 0.02
R6813:Olfr877 UTSW 9 37855514 missense possibly damaging 0.83
R7315:Olfr877 UTSW 9 37855247 missense probably benign
R7500:Olfr877 UTSW 9 37855018 missense probably damaging 1.00
R8021:Olfr877 UTSW 9 37855296 missense probably damaging 1.00
Z1088:Olfr877 UTSW 9 37855318 missense probably benign 0.31
Z1177:Olfr877 UTSW 9 37855498 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CATTGGAGTGCCCATTGTTAC -3'
(R):5'- GGTTTTCCTGCTGTTATAACACTGC -3'

Sequencing Primer
(F):5'- GTGCCCATTGTTACCATTTTTATATC -3'
(R):5'- GCTGTTATAACACTGCCTTTTATTTC -3'
Posted On2019-05-13