Incidental Mutation 'R7061:Neo1'
ID548273
Institutional Source Beutler Lab
Gene Symbol Neo1
Ensembl Gene ENSMUSG00000032340
Gene Nameneogenin
Synonyms2610028H22Rik, D930014N22Rik, Igdcc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location58874687-59036441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58990441 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 77 (R77S)
Ref Sequence ENSEMBL: ENSMUSP00000150600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068664] [ENSMUST00000214547]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068664
AA Change: R77S

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063656
Gene: ENSMUSG00000032340
AA Change: R77S

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
IGc2 76 147 9.49e-5 SMART
IGc2 175 239 4.43e-5 SMART
IGc2 272 338 6.15e-13 SMART
IGc2 364 428 7.76e-10 SMART
low complexity region 446 458 N/A INTRINSIC
FN3 470 553 8.23e-12 SMART
FN3 570 649 1.78e-16 SMART
FN3 665 749 1.54e-11 SMART
FN3 770 849 5.27e-10 SMART
FN3 885 970 7.63e-7 SMART
FN3 986 1072 2.78e-9 SMART
transmembrane domain 1136 1158 N/A INTRINSIC
Pfam:Neogenin_C 1189 1492 1.9e-122 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214547
AA Change: R77S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display perinatal lethality and abnormal trigeminal nerve development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Neo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Neo1 APN 9 58921919 splice site probably benign
IGL00885:Neo1 APN 9 58888463 missense probably damaging 1.00
IGL01103:Neo1 APN 9 58880799 missense possibly damaging 0.60
IGL01322:Neo1 APN 9 58907085 missense possibly damaging 0.68
IGL02216:Neo1 APN 9 58917053 missense probably damaging 0.96
IGL02327:Neo1 APN 9 58903088 missense probably benign 0.08
IGL02392:Neo1 APN 9 58925811 missense possibly damaging 0.49
IGL02458:Neo1 APN 9 58893867 splice site probably benign
IGL03057:Neo1 APN 9 58878059 missense probably damaging 1.00
IGL03091:Neo1 APN 9 58978668 missense probably damaging 0.98
IGL03193:Neo1 APN 9 58908484 missense probably damaging 1.00
R0097:Neo1 UTSW 9 58882021 intron probably benign
R0419:Neo1 UTSW 9 58990180 splice site probably benign
R0571:Neo1 UTSW 9 58985786 missense probably benign
R0646:Neo1 UTSW 9 58931034 missense probably damaging 1.00
R0736:Neo1 UTSW 9 58917081 missense possibly damaging 0.78
R0739:Neo1 UTSW 9 58921877 missense probably benign 0.22
R1636:Neo1 UTSW 9 58913277 missense probably damaging 1.00
R1694:Neo1 UTSW 9 58880603 missense probably damaging 1.00
R1827:Neo1 UTSW 9 58917031 nonsense probably null
R1927:Neo1 UTSW 9 58990385 missense probably benign 0.12
R2354:Neo1 UTSW 9 58985634 missense probably benign
R2365:Neo1 UTSW 9 58956003 missense probably benign
R3156:Neo1 UTSW 9 58888979 splice site probably null
R3552:Neo1 UTSW 9 58893878 missense probably damaging 1.00
R3829:Neo1 UTSW 9 58913169 missense possibly damaging 0.58
R4477:Neo1 UTSW 9 58877299 missense probably damaging 0.99
R4613:Neo1 UTSW 9 58889041 missense possibly damaging 0.94
R5023:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5046:Neo1 UTSW 9 58893911 missense possibly damaging 0.77
R5057:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5323:Neo1 UTSW 9 58906648 critical splice donor site probably null
R5394:Neo1 UTSW 9 58990234 missense probably benign 0.10
R5470:Neo1 UTSW 9 58931067 missense probably damaging 1.00
R5473:Neo1 UTSW 9 58880843 missense possibly damaging 0.88
R5500:Neo1 UTSW 9 58917054 missense possibly damaging 0.94
R5503:Neo1 UTSW 9 58985650 missense possibly damaging 0.67
R6122:Neo1 UTSW 9 58917008 missense probably benign
R6191:Neo1 UTSW 9 58889029 missense probably damaging 1.00
R6431:Neo1 UTSW 9 58907071 missense probably benign 0.27
R6560:Neo1 UTSW 9 58880601 missense possibly damaging 0.95
R6658:Neo1 UTSW 9 58921849 missense probably benign 0.14
R6772:Neo1 UTSW 9 58902976 missense probably damaging 1.00
R6912:Neo1 UTSW 9 58917052 missense probably benign 0.00
R7145:Neo1 UTSW 9 58889179 missense probably damaging 1.00
R7156:Neo1 UTSW 9 58902923 missense probably damaging 1.00
R7485:Neo1 UTSW 9 58884543 missense probably benign 0.04
R7519:Neo1 UTSW 9 58878065 missense probably benign 0.13
R7615:Neo1 UTSW 9 58884503 missense probably benign 0.07
R7665:Neo1 UTSW 9 58925795 missense probably damaging 1.00
R7695:Neo1 UTSW 9 58902929 missense possibly damaging 0.81
R7753:Neo1 UTSW 9 58956005 missense probably benign 0.00
R7807:Neo1 UTSW 9 58990494 missense probably benign 0.01
R7915:Neo1 UTSW 9 58930981 missense probably benign 0.42
R7973:Neo1 UTSW 9 58990193 missense probably damaging 1.00
R8356:Neo1 UTSW 9 58878119 missense probably damaging 1.00
R8505:Neo1 UTSW 9 58913283 missense probably benign 0.02
R8700:Neo1 UTSW 9 58918630 missense probably benign 0.28
R8798:Neo1 UTSW 9 58913166 missense probably damaging 1.00
X0063:Neo1 UTSW 9 58990298 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTCCAAGATTATCCACAGTGGC -3'
(R):5'- GACATCAATGGCATATCATTCAGC -3'

Sequencing Primer
(F):5'- GTGGCTACACACTGATAGAAACCTTC -3'
(R):5'- TGGCATATCATTCAGCAATAATCTG -3'
Posted On2019-05-13