Incidental Mutation 'R7061:Grm2'
ID548274
Institutional Source Beutler Lab
Gene Symbol Grm2
Ensembl Gene ENSMUSG00000023192
Gene Nameglutamate receptor, metabotropic 2
Synonyms4930441L02Rik, mGluR2, Gprc1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location106643095-106656082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106651225 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 153 (N153K)
Ref Sequence ENSEMBL: ENSMUSP00000023959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023959] [ENSMUST00000201681]
Predicted Effect probably damaging
Transcript: ENSMUST00000023959
AA Change: N153K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023959
Gene: ENSMUSG00000023192
AA Change: N153K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 60 460 1.3e-96 PFAM
Pfam:NCD3G 496 546 3.7e-13 PFAM
Pfam:7tm_3 579 816 4.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200826
Predicted Effect possibly damaging
Transcript: ENSMUST00000201681
AA Change: N153K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144631
Gene: ENSMUSG00000023192
AA Change: N153K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 60 460 4.1e-95 PFAM
Pfam:7tm_3 458 538 4.6e-18 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile behavioral modifications and moderate abnormalities in long term depression and EPSP in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Grm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1053:Grm2 UTSW 9 106648157 missense probably damaging 0.98
R1116:Grm2 UTSW 9 106647927 missense probably damaging 0.97
R1593:Grm2 UTSW 9 106650914 missense probably damaging 1.00
R1619:Grm2 UTSW 9 106647471 missense probably damaging 1.00
R2174:Grm2 UTSW 9 106647795 missense probably benign 0.05
R2357:Grm2 UTSW 9 106647581 missense probably damaging 0.99
R3115:Grm2 UTSW 9 106647623 missense probably damaging 0.97
R4453:Grm2 UTSW 9 106653879 missense probably damaging 0.97
R4700:Grm2 UTSW 9 106653931 missense probably benign 0.18
R4854:Grm2 UTSW 9 106654132 missense possibly damaging 0.80
R4871:Grm2 UTSW 9 106647645 missense probably benign 0.00
R4888:Grm2 UTSW 9 106650666 missense probably damaging 0.98
R4999:Grm2 UTSW 9 106653990 missense probably damaging 1.00
R5617:Grm2 UTSW 9 106651076 splice site probably null
R5620:Grm2 UTSW 9 106650446 missense probably damaging 0.96
R6021:Grm2 UTSW 9 106650800 missense probably damaging 1.00
R6089:Grm2 UTSW 9 106653891 missense probably damaging 1.00
R6662:Grm2 UTSW 9 106648053 missense probably benign 0.01
R7266:Grm2 UTSW 9 106647171 missense
R7270:Grm2 UTSW 9 106651058 missense probably damaging 0.98
R7479:Grm2 UTSW 9 106653851 missense possibly damaging 0.84
R7542:Grm2 UTSW 9 106651169 missense probably damaging 0.98
Z1177:Grm2 UTSW 9 106645065 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGCCACCGTAGACACATACG -3'
(R):5'- ACATGGTCCTGGGTGTTCTC -3'

Sequencing Primer
(F):5'- CGTAGACACATACGTCCAGTTG -3'
(R):5'- GGGAGGAAAGAAACCCTCTATC -3'
Posted On2019-05-13