Incidental Mutation 'R7061:Ugt3a1'
ID 548285
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene Name UDP glycosyltransferases 3 family, polypeptide A1
Synonyms Ugt3a2
MMRRC Submission 045384-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R7061 (G1)
Quality Score 169.009
Status Validated
Chromosome 15
Chromosomal Location 9335670-9370960 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 9306240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 130 (M130L)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861]
AlphaFold Q3UP75
Predicted Effect probably benign
Transcript: ENSMUST00000022861
AA Change: M130L

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: M130L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard G A 15: 51,903,617 (GRCm39) M13I probably benign Het
Abcb5 A C 12: 118,841,509 (GRCm39) Y979D probably damaging Het
Adgrb1 G C 15: 74,441,730 (GRCm39) V4L probably benign Het
Ap3b2 C T 7: 81,110,757 (GRCm39) R1006Q unknown Het
Bpifa6 A T 2: 153,834,236 (GRCm39) T343S probably benign Het
Celsr3 T A 9: 108,724,793 (GRCm39) C2957* probably null Het
Chd6 G A 2: 160,867,885 (GRCm39) Q428* probably null Het
Col5a1 C A 2: 27,915,690 (GRCm39) C191* probably null Het
Cpox A G 16: 58,491,223 (GRCm39) I145V possibly damaging Het
Csnk2a1 C T 2: 152,116,091 (GRCm39) R268C probably benign Het
Dclk2 A G 3: 86,739,038 (GRCm39) probably null Het
Dennd5a T C 7: 109,504,386 (GRCm39) E909G probably benign Het
Depdc1a T A 3: 159,228,489 (GRCm39) S414T possibly damaging Het
Dock5 A G 14: 68,007,703 (GRCm39) F1502S probably damaging Het
Dop1b G T 16: 93,558,951 (GRCm39) A448S probably benign Het
Dsg1c C A 18: 20,410,066 (GRCm39) N511K probably benign Het
Epc2 G T 2: 49,425,334 (GRCm39) R108L probably damaging Het
Erp44 T A 4: 48,219,375 (GRCm39) I147F probably benign Het
Evc T C 5: 37,476,446 (GRCm39) T368A possibly damaging Het
Fbxo41 G T 6: 85,452,448 (GRCm39) R738S probably benign Het
Fli1 T C 9: 32,335,518 (GRCm39) T305A probably damaging Het
Grk5 A G 19: 61,034,530 (GRCm39) T93A probably benign Het
Grm2 A T 9: 106,528,424 (GRCm39) N153K probably damaging Het
Helz A G 11: 107,540,003 (GRCm39) T1007A possibly damaging Het
Helz2 A G 2: 180,882,307 (GRCm39) L162P probably damaging Het
Hmgcr T A 13: 96,802,656 (GRCm39) Q81L possibly damaging Het
Hnrnpu T C 1: 178,163,691 (GRCm39) K218E unknown Het
Hydin A T 8: 111,329,920 (GRCm39) I4885F possibly damaging Het
Ibsp A G 5: 104,457,768 (GRCm39) probably null Het
Igfals T C 17: 25,099,281 (GRCm39) L124P probably damaging Het
Il24 T A 1: 130,811,108 (GRCm39) H142L possibly damaging Het
Iqca1l A G 5: 24,750,063 (GRCm39) M660T probably benign Het
Kcnh2 A T 5: 24,536,920 (GRCm39) H221Q probably benign Het
Man1a A G 10: 53,796,331 (GRCm39) S454P probably damaging Het
Meiosin A T 7: 18,834,053 (GRCm39) probably benign Het
Mfsd4b1 C T 10: 39,879,382 (GRCm39) V172M possibly damaging Het
Mical2 T A 7: 111,946,008 (GRCm39) I763K probably benign Het
Mybpc3 A G 2: 90,955,749 (GRCm39) I594M possibly damaging Het
Neo1 T A 9: 58,897,724 (GRCm39) R77S possibly damaging Het
Nlrp6 A G 7: 140,502,780 (GRCm39) I265M probably benign Het
Or52n5 T C 7: 104,587,883 (GRCm39) L50P probably damaging Het
Or5bw2 A G 7: 6,573,782 (GRCm39) Y264C probably damaging Het
Or8b9 T A 9: 37,766,942 (GRCm39) V276D possibly damaging Het
Pcdhgb5 C A 18: 37,864,976 (GRCm39) P257Q probably benign Het
Phactr1 A G 13: 43,286,457 (GRCm39) D586G probably damaging Het
Pkn3 T A 2: 29,973,548 (GRCm39) probably null Het
Prob1 A T 18: 35,787,553 (GRCm39) S234T probably benign Het
Rab14 A T 2: 35,073,429 (GRCm39) L131* probably null Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rhebl1 A G 15: 98,777,164 (GRCm39) L103P probably damaging Het
Rnf10 G T 5: 115,395,149 (GRCm39) F146L probably damaging Het
Rrbp1 T C 2: 143,831,087 (GRCm39) K360R possibly damaging Het
Slc6a9 C T 4: 117,725,261 (GRCm39) T575I probably benign Het
Smo A G 6: 29,760,229 (GRCm39) H776R probably damaging Het
Speer1f T C 5: 11,469,071 (GRCm39) V74A possibly damaging Het
Tns2 A G 15: 102,012,914 (GRCm39) M1V probably null Het
Ttn C A 2: 76,725,036 (GRCm39) probably benign Het
Urb2 C T 8: 124,755,036 (GRCm39) H248Y probably benign Het
Vit A T 17: 78,932,585 (GRCm39) N564I probably damaging Het
Vmn1r60 A T 7: 5,547,310 (GRCm39) Y263* probably null Het
Vmn2r16 A T 5: 109,511,620 (GRCm39) Y609F probably damaging Het
Xpo7 T C 14: 70,908,512 (GRCm39) I876V probably benign Het
Zfp442 A G 2: 150,249,937 (GRCm39) I655T probably benign Het
Zfp574 T A 7: 24,779,622 (GRCm39) C215S possibly damaging Het
Zfp608 T C 18: 55,121,069 (GRCm39) T173A probably benign Het
Zfp69 A T 4: 120,788,598 (GRCm39) V239D possibly damaging Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9,310,698 (GRCm39) missense probably damaging 1.00
IGL01109:Ugt3a1 APN 15 9,367,354 (GRCm39) missense probably damaging 0.99
IGL01131:Ugt3a1 APN 15 9,365,248 (GRCm39) missense probably damaging 1.00
IGL01627:Ugt3a1 APN 15 9,335,806 (GRCm39) missense probably damaging 1.00
IGL01746:Ugt3a1 APN 15 9,361,754 (GRCm39) missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9,306,232 (GRCm39) missense probably damaging 1.00
IGL01949:Ugt3a1 APN 15 9,335,815 (GRCm39) missense probably damaging 1.00
IGL02213:Ugt3a1 APN 15 9,370,310 (GRCm39) missense probably benign 0.00
IGL02407:Ugt3a1 APN 15 9,365,316 (GRCm39) nonsense probably null
IGL02438:Ugt3a1 APN 15 9,292,062 (GRCm39) missense possibly damaging 0.90
IGL02588:Ugt3a1 APN 15 9,361,542 (GRCm39) missense probably benign
IGL02894:Ugt3a1 APN 15 9,367,487 (GRCm39) missense probably damaging 1.00
IGL02966:Ugt3a1 APN 15 9,370,154 (GRCm39) missense probably damaging 1.00
IGL03385:Ugt3a1 APN 15 9,338,824 (GRCm39) missense probably damaging 0.99
IGL03493:Ugt3a1 APN 15 9,361,569 (GRCm39) missense probably damaging 0.96
PIT4354001:Ugt3a1 UTSW 15 9,306,446 (GRCm39) nonsense probably null
R0127:Ugt3a1 UTSW 15 9,306,342 (GRCm39) missense probably benign 0.01
R0554:Ugt3a1 UTSW 15 9,351,206 (GRCm39) missense probably benign 0.14
R0647:Ugt3a1 UTSW 15 9,310,635 (GRCm39) missense probably benign 0.00
R0833:Ugt3a1 UTSW 15 9,370,236 (GRCm39) missense probably damaging 0.96
R0841:Ugt3a1 UTSW 15 9,306,214 (GRCm39) missense probably benign 0.07
R1071:Ugt3a1 UTSW 15 9,367,454 (GRCm39) missense possibly damaging 0.82
R1395:Ugt3a1 UTSW 15 9,306,378 (GRCm39) missense possibly damaging 0.92
R1513:Ugt3a1 UTSW 15 9,361,610 (GRCm39) missense probably benign 0.07
R1616:Ugt3a1 UTSW 15 9,306,330 (GRCm39) nonsense probably null
R1844:Ugt3a1 UTSW 15 9,351,254 (GRCm39) missense probably benign 0.07
R1874:Ugt3a1 UTSW 15 9,365,437 (GRCm39) missense probably damaging 1.00
R2305:Ugt3a1 UTSW 15 9,351,203 (GRCm39) missense probably benign
R2338:Ugt3a1 UTSW 15 9,292,059 (GRCm39) splice site probably benign
R3052:Ugt3a1 UTSW 15 9,365,374 (GRCm39) missense probably damaging 1.00
R3755:Ugt3a1 UTSW 15 9,367,498 (GRCm39) missense probably benign 0.21
R3797:Ugt3a1 UTSW 15 9,310,727 (GRCm39) nonsense probably null
R3945:Ugt3a1 UTSW 15 9,370,184 (GRCm39) missense possibly damaging 0.91
R4135:Ugt3a1 UTSW 15 9,338,810 (GRCm39) missense probably damaging 0.98
R4261:Ugt3a1 UTSW 15 9,335,879 (GRCm39) splice site probably null
R4305:Ugt3a1 UTSW 15 9,306,360 (GRCm39) missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9,306,565 (GRCm39) missense probably benign 0.15
R4438:Ugt3a1 UTSW 15 9,351,283 (GRCm39) missense probably benign 0.01
R4570:Ugt3a1 UTSW 15 9,338,807 (GRCm39) missense probably benign 0.12
R4572:Ugt3a1 UTSW 15 9,306,479 (GRCm39) missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9,306,486 (GRCm39) nonsense probably null
R4744:Ugt3a1 UTSW 15 9,310,639 (GRCm39) missense probably benign 0.36
R4791:Ugt3a1 UTSW 15 9,361,665 (GRCm39) missense probably damaging 1.00
R4957:Ugt3a1 UTSW 15 9,365,274 (GRCm39) missense probably benign 0.27
R5011:Ugt3a1 UTSW 15 9,365,373 (GRCm39) missense probably damaging 1.00
R5035:Ugt3a1 UTSW 15 9,361,704 (GRCm39) missense probably benign 0.01
R5554:Ugt3a1 UTSW 15 9,370,287 (GRCm39) missense probably damaging 1.00
R5573:Ugt3a1 UTSW 15 9,361,769 (GRCm39) missense probably damaging 1.00
R5631:Ugt3a1 UTSW 15 9,361,971 (GRCm39) missense probably damaging 0.98
R5696:Ugt3a1 UTSW 15 9,361,534 (GRCm39) splice site silent
R5715:Ugt3a1 UTSW 15 9,306,430 (GRCm39) missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9,306,172 (GRCm39) missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9,306,172 (GRCm39) missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9,310,762 (GRCm39) missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9,310,726 (GRCm39) missense possibly damaging 0.81
R6265:Ugt3a1 UTSW 15 9,361,665 (GRCm39) missense probably damaging 1.00
R6302:Ugt3a1 UTSW 15 9,365,397 (GRCm39) missense probably damaging 1.00
R6311:Ugt3a1 UTSW 15 9,361,604 (GRCm39) nonsense probably null
R6344:Ugt3a1 UTSW 15 9,306,317 (GRCm39) missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9,306,541 (GRCm39) missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9,306,541 (GRCm39) missense probably benign 0.00
R6680:Ugt3a1 UTSW 15 9,370,154 (GRCm39) missense probably damaging 1.00
R6737:Ugt3a1 UTSW 15 9,311,895 (GRCm39) missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9,280,138 (GRCm39) splice site probably null
R6937:Ugt3a1 UTSW 15 9,292,158 (GRCm39) missense probably benign 0.00
R7672:Ugt3a1 UTSW 15 9,310,779 (GRCm39) nonsense probably null
R7840:Ugt3a1 UTSW 15 9,311,903 (GRCm39) missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9,284,261 (GRCm39) critical splice donor site probably null
R8105:Ugt3a1 UTSW 15 9,306,476 (GRCm39) missense probably benign 0.00
R8229:Ugt3a1 UTSW 15 9,367,463 (GRCm39) missense probably damaging 0.99
R8296:Ugt3a1 UTSW 15 9,362,024 (GRCm39) missense probably benign 0.18
R8414:Ugt3a1 UTSW 15 9,310,669 (GRCm39) missense possibly damaging 0.82
R8809:Ugt3a1 UTSW 15 9,367,345 (GRCm39) missense possibly damaging 0.69
R8981:Ugt3a1 UTSW 15 9,312,014 (GRCm39) missense probably benign 0.20
R9066:Ugt3a1 UTSW 15 9,367,384 (GRCm39) missense possibly damaging 0.94
R9071:Ugt3a1 UTSW 15 9,370,224 (GRCm39) nonsense probably null
R9111:Ugt3a1 UTSW 15 9,306,333 (GRCm39) missense possibly damaging 0.69
R9151:Ugt3a1 UTSW 15 9,362,051 (GRCm39) missense probably benign 0.03
R9451:Ugt3a1 UTSW 15 9,292,158 (GRCm39) missense probably benign 0.00
R9522:Ugt3a1 UTSW 15 9,370,209 (GRCm39) missense probably damaging 1.00
R9567:Ugt3a1 UTSW 15 9,306,370 (GRCm39) missense possibly damaging 0.82
R9609:Ugt3a1 UTSW 15 9,361,905 (GRCm39) missense probably damaging 1.00
R9657:Ugt3a1 UTSW 15 9,280,133 (GRCm39) missense probably damaging 0.98
Z1177:Ugt3a1 UTSW 15 9,367,343 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTACAGAGCCTCTTTCCTTAA -3'
(R):5'- TACACTGGAGCATATGACAAGG -3'

Sequencing Primer
(F):5'- AATCCTAAGCCTACCTTAAACTCTTG -3'
(R):5'- CAAGGGGGCGTTTGGTAACC -3'
Posted On 2019-05-13