Incidental Mutation 'R7061:Adgrb1'
ID548287
Institutional Source Beutler Lab
Gene Symbol Adgrb1
Ensembl Gene ENSMUSG00000034730
Gene Nameadhesion G protein-coupled receptor B1
SynonymsBai1, B830018M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location74516195-74589465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 74569881 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 4 (V4L)
Ref Sequence ENSEMBL: ENSMUSP00000140407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000170845] [ENSMUST00000185682] [ENSMUST00000186360] [ENSMUST00000187485] [ENSMUST00000187599] [ENSMUST00000189353] [ENSMUST00000190524]
Predicted Effect probably benign
Transcript: ENSMUST00000042035
AA Change: V944L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: V944L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 4.69e-10 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 3.5e-9 SMART
TSP1 412 462 3.16e-16 SMART
TSP1 470 520 7.15e-15 SMART
TSP1 525 575 3.11e-15 SMART
HormR 577 643 2.55e-20 SMART
Pfam:GAIN 656 859 1e-46 PFAM
GPS 880 938 1.46e-18 SMART
Pfam:7tm_2 944 1180 3.3e-66 PFAM
SCOP:d1jvr__ 1396 1432 5e-4 SMART
low complexity region 1441 1455 N/A INTRINSIC
low complexity region 1545 1556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170845
AA Change: V4L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127122
Gene: ENSMUSG00000034730
AA Change: V4L

DomainStartEndE-ValueType
Pfam:7tm_2 4 240 1.9e-67 PFAM
SCOP:d1jvr__ 456 492 1e-3 SMART
low complexity region 501 515 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185682
AA Change: V4L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139428
Gene: ENSMUSG00000034730
AA Change: V4L

DomainStartEndE-ValueType
Pfam:7tm_2 4 240 1.9e-67 PFAM
SCOP:d1jvr__ 456 492 1e-3 SMART
low complexity region 501 515 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186360
AA Change: V944L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: V944L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 1.7e-11 SMART
TSP1 412 462 1.5e-18 SMART
TSP1 470 520 3.4e-17 SMART
TSP1 525 575 1.5e-17 SMART
HormR 577 643 1.6e-22 SMART
Pfam:DUF3497 653 874 1.2e-44 PFAM
GPS 880 938 8.9e-21 SMART
Pfam:7tm_2 944 1106 9.6e-43 PFAM
low complexity region 1113 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187485
SMART Domains Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187599
AA Change: V4L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140831
Gene: ENSMUSG00000034730
AA Change: V4L

DomainStartEndE-ValueType
Pfam:7tm_2 4 135 6.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189353
AA Change: V4L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140889
Gene: ENSMUSG00000034730
AA Change: V4L

DomainStartEndE-ValueType
Pfam:7tm_2 4 147 3.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190524
AA Change: V4L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140407
Gene: ENSMUSG00000034730
AA Change: V4L

DomainStartEndE-ValueType
Pfam:7tm_2 4 112 4.3e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Adgrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Adgrb1 APN 15 74586835 missense probably damaging 1.00
IGL01748:Adgrb1 APN 15 74548357 splice site probably benign
IGL01874:Adgrb1 APN 15 74541574 missense possibly damaging 0.95
IGL02040:Adgrb1 APN 15 74541575 missense possibly damaging 0.91
IGL02138:Adgrb1 APN 15 74529782 missense probably damaging 1.00
IGL02149:Adgrb1 APN 15 74540477 missense probably damaging 1.00
IGL02320:Adgrb1 APN 15 74574112 missense probably damaging 1.00
IGL02556:Adgrb1 APN 15 74586805 missense probably damaging 0.99
IGL02637:Adgrb1 APN 15 74588294 splice site probably benign
IGL02678:Adgrb1 APN 15 74538328 missense probably damaging 0.99
IGL02792:Adgrb1 APN 15 74547622 missense probably damaging 0.98
Bunting UTSW 15 74543701 missense probably null 0.94
PIT4520001:Adgrb1 UTSW 15 74541659 missense probably damaging 0.99
R0193:Adgrb1 UTSW 15 74572156 missense probably damaging 1.00
R0208:Adgrb1 UTSW 15 74586807 missense probably benign
R0267:Adgrb1 UTSW 15 74529389 missense probably damaging 1.00
R0336:Adgrb1 UTSW 15 74587149 missense probably benign 0.06
R0345:Adgrb1 UTSW 15 74543349 missense probably damaging 0.97
R0533:Adgrb1 UTSW 15 74541559 missense probably damaging 1.00
R0635:Adgrb1 UTSW 15 74540892 missense possibly damaging 0.88
R0729:Adgrb1 UTSW 15 74548549 missense probably damaging 1.00
R0792:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1122:Adgrb1 UTSW 15 74547685 missense probably damaging 0.99
R1295:Adgrb1 UTSW 15 74550039 missense probably damaging 1.00
R1522:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1696:Adgrb1 UTSW 15 74588107 missense probably damaging 1.00
R1707:Adgrb1 UTSW 15 74529343 missense probably damaging 0.99
R1750:Adgrb1 UTSW 15 74541827 missense probably benign 0.23
R1804:Adgrb1 UTSW 15 74529540 missense probably damaging 1.00
R1829:Adgrb1 UTSW 15 74580586 nonsense probably null
R1895:Adgrb1 UTSW 15 74540465 missense probably damaging 1.00
R1970:Adgrb1 UTSW 15 74539877 splice site probably benign
R2114:Adgrb1 UTSW 15 74540562 critical splice donor site probably null
R2133:Adgrb1 UTSW 15 74529908 missense probably damaging 1.00
R2210:Adgrb1 UTSW 15 74547704 missense probably damaging 1.00
R3701:Adgrb1 UTSW 15 74545015 missense probably damaging 0.99
R3770:Adgrb1 UTSW 15 74588308 missense probably damaging 1.00
R3980:Adgrb1 UTSW 15 74582943 missense probably damaging 1.00
R4355:Adgrb1 UTSW 15 74543662 missense probably damaging 1.00
R4412:Adgrb1 UTSW 15 74577453 unclassified probably benign
R4634:Adgrb1 UTSW 15 74584429 utr 3 prime probably benign
R4683:Adgrb1 UTSW 15 74588114 missense probably damaging 1.00
R4742:Adgrb1 UTSW 15 74529479 nonsense probably null
R4760:Adgrb1 UTSW 15 74571463 missense probably damaging 1.00
R4794:Adgrb1 UTSW 15 74588129 missense probably damaging 1.00
R4880:Adgrb1 UTSW 15 74587022 missense possibly damaging 0.85
R4885:Adgrb1 UTSW 15 74572162 missense probably benign 0.04
R5092:Adgrb1 UTSW 15 74529815 missense probably benign 0.39
R5198:Adgrb1 UTSW 15 74543701 missense probably null 0.94
R5225:Adgrb1 UTSW 15 74577499 unclassified probably benign
R5421:Adgrb1 UTSW 15 74550027 missense probably damaging 1.00
R5764:Adgrb1 UTSW 15 74541574 missense possibly damaging 0.95
R5914:Adgrb1 UTSW 15 74538370 missense possibly damaging 0.54
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6066:Adgrb1 UTSW 15 74540459 missense probably damaging 0.99
R6423:Adgrb1 UTSW 15 74588143 critical splice donor site probably null
R6811:Adgrb1 UTSW 15 74529361 missense probably damaging 1.00
R6945:Adgrb1 UTSW 15 74550024 missense probably damaging 0.99
R7012:Adgrb1 UTSW 15 74529901 missense probably damaging 0.97
R7015:Adgrb1 UTSW 15 74574110 missense probably damaging 1.00
R7209:Adgrb1 UTSW 15 74569948 missense possibly damaging 0.85
R7213:Adgrb1 UTSW 15 74569884 missense probably benign
R7283:Adgrb1 UTSW 15 74580663 missense possibly damaging 0.94
R7329:Adgrb1 UTSW 15 74539245 missense probably damaging 0.99
R7616:Adgrb1 UTSW 15 74548569 missense probably damaging 0.98
R7695:Adgrb1 UTSW 15 74543638 missense possibly damaging 0.95
Z1177:Adgrb1 UTSW 15 74541676 missense probably damaging 1.00
Z1177:Adgrb1 UTSW 15 74547683 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGCCTGCTACTGTCATTATAC -3'
(R):5'- TAGCTGGTCCAGAGTAGATGG -3'

Sequencing Primer
(F):5'- CTGCTACTGTCATTATACTTGTGAG -3'
(R):5'- CTGGTCCAGAGTAGATGGTACAAG -3'
Posted On2019-05-13