Mutagenetix > Incidental Mutation

Incidental Mutation 'R7061:Tns2'

548289

Institutional Source

Beutler Lab

Gene Symbol

Tns2

Ensembl Gene

ENSMUSG00000037003

Gene Name

tensin 2

Synonyms

nph, nep, Tenc1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7061 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102100413-102116401 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

A to G at 102104479 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1 (M1V)

Ref Sequence

ENSEMBL: ENSMUSP00000155309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]

AlphaFold

Q8CGB6

Predicted Effect

probably benign
Transcript: ENSMUST00000046144

SMART Domains

Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1136	1236	1.69e-16	SMART
PTB	1269	1407	6.66e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169627

SMART Domains

Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003

Domain	Start	End	E-Value	Type
C1	32	79	2.78e-9	SMART
SCOP:d1d5ra2	128	295	8e-24	SMART
PTEN_C2	297	424	6.63e-40	SMART
low complexity region	494	513	N/A	INTRINSIC
SH2	1129	1229	1.69e-16	SMART
PTB	1262	1400	6.66e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000228958

Predicted Effect

probably benign
Transcript: ENSMUST00000229592

Predicted Effect

probably null
Transcript: ENSMUST00000230474
AA Change: M1V

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,545,065	M660T	probably benign	Het
Aard	G	A	15: 52,040,221	M13I	probably benign	Het
Abcb5	A	C	12: 118,877,774	Y979D	probably damaging	Het
Adgrb1	G	C	15: 74,569,881	V4L	probably benign	Het
Ap3b2	C	T	7: 81,461,009	R1006Q	unknown	Het
Bpifa6	A	T	2: 153,992,316	T343S	probably benign	Het
Celsr3	T	A	9: 108,847,594	C2957*	probably null	Het
Chd6	G	A	2: 161,025,965	Q428*	probably null	Het
Col5a1	C	A	2: 28,025,678	C191*	probably null	Het
Cpox	A	G	16: 58,670,860	I145V	possibly damaging	Het
Csnk2a1	C	T	2: 152,274,171	R268C	probably benign	Het
Dclk2	A	G	3: 86,831,731		probably null	Het
Dennd5a	T	C	7: 109,905,179	E909G	probably benign	Het
Depdc1a	T	A	3: 159,522,852	S414T	possibly damaging	Het
Dock5	A	G	14: 67,770,254	F1502S	probably damaging	Het
Dopey2	G	T	16: 93,762,063	A448S	probably benign	Het
Dsg1c	C	A	18: 20,277,009	N511K	probably benign	Het
Epc2	G	T	2: 49,535,322	R108L	probably damaging	Het
Erp44	T	A	4: 48,219,375	I147F	probably benign	Het
Evc	T	C	5: 37,319,102	T368A	possibly damaging	Het
Fbxo41	G	T	6: 85,475,466	R738S	probably benign	Het
Fli1	T	C	9: 32,424,222	T305A	probably damaging	Het
Gm4969	A	T	7: 19,100,128		probably benign	Het
Gm8897	T	C	5: 11,419,104	V74A	possibly damaging	Het
Grk5	A	G	19: 61,046,092	T93A	probably benign	Het
Grm2	A	T	9: 106,651,225	N153K	probably damaging	Het
Helz	A	G	11: 107,649,177	T1007A	possibly damaging	Het
Helz2	A	G	2: 181,240,514	L162P	probably damaging	Het
Hmgcr	T	A	13: 96,666,148	Q81L	possibly damaging	Het
Hnrnpu	T	C	1: 178,336,126	K218E	unknown	Het
Hydin	A	T	8: 110,603,288	I4885F	possibly damaging	Het
Ibsp	A	G	5: 104,309,902		probably null	Het
Igfals	T	C	17: 24,880,307	L124P	probably damaging	Het
Il24	T	A	1: 130,883,371	H142L	possibly damaging	Het
Kcnh2	A	T	5: 24,331,922	H221Q	probably benign	Het
Man1a	A	G	10: 53,920,235	S454P	probably damaging	Het
Mfsd4b1	C	T	10: 40,003,386	V172M	possibly damaging	Het
Mical2	T	A	7: 112,346,801	I763K	probably benign	Het
Mybpc3	A	G	2: 91,125,404	I594M	possibly damaging	Het
Neo1	T	A	9: 58,990,441	R77S	possibly damaging	Het
Nlrp6	A	G	7: 140,922,867	I265M	probably benign	Het
Olfr1350	A	G	7: 6,570,783	Y264C	probably damaging	Het
Olfr669	T	C	7: 104,938,676	L50P	probably damaging	Het
Olfr877	T	A	9: 37,855,646	V276D	possibly damaging	Het
Pcdhgb5	C	A	18: 37,731,923	P257Q	probably benign	Het
Phactr1	A	G	13: 43,132,981	D586G	probably damaging	Het
Pkn3	T	A	2: 30,083,536		probably null	Het
Prob1	A	T	18: 35,654,500	S234T	probably benign	Het
Rab14	A	T	2: 35,183,417	L131*	probably null	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rhebl1	A	G	15: 98,879,283	L103P	probably damaging	Het
Rnf10	G	T	5: 115,257,090	F146L	probably damaging	Het
Rrbp1	T	C	2: 143,989,167	K360R	possibly damaging	Het
Slc6a9	C	T	4: 117,868,064	T575I	probably benign	Het
Smo	A	G	6: 29,760,230	H776R	probably damaging	Het
Ttn	C	A	2: 76,894,692		probably benign	Het
Ugt3a1	A	T	15: 9,306,154	M130L	probably benign	Het
Urb2	C	T	8: 124,028,297	H248Y	probably benign	Het
Vit	A	T	17: 78,625,156	N564I	probably damaging	Het
Vmn1r60	A	T	7: 5,544,311	Y263*	probably null	Het
Vmn2r16	A	T	5: 109,363,754	Y609F	probably damaging	Het
Xpo7	T	C	14: 70,671,072	I876V	probably benign	Het
Zfp442	A	G	2: 150,408,017	I655T	probably benign	Het
Zfp574	T	A	7: 25,080,197	C215S	possibly damaging	Het
Zfp608	T	C	18: 54,987,997	T173A	probably benign	Het
Zfp69	A	T	4: 120,931,401	V239D	possibly damaging	Het

Other mutations in Tns2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01575:Tns2	APN	15	102113191	missense	probably damaging	1.00
IGL01935:Tns2	APN	15	102111634	splice site	probably null
IGL01994:Tns2	APN	15	102111379	missense	possibly damaging	0.81
IGL02025:Tns2	APN	15	102112049	nonsense	probably null
IGL02135:Tns2	APN	15	102113026	missense	probably damaging	1.00
IGL02355:Tns2	APN	15	102112290	missense	probably benign
IGL02362:Tns2	APN	15	102112290	missense	probably benign
IGL02439:Tns2	APN	15	102114543	missense	probably damaging	1.00
IGL02488:Tns2	APN	15	102112743	missense	probably benign
IGL02546:Tns2	APN	15	102110940	missense	probably damaging	1.00
IGL02616:Tns2	APN	15	102111415	missense	probably benign
IGL02628:Tns2	APN	15	102111828	missense	probably benign	0.04
IGL02658:Tns2	APN	15	102107796	splice site	probably benign
IGL03267:Tns2	APN	15	102105378	critical splice donor site	probably null
P0005:Tns2	UTSW	15	102114056	missense	probably damaging	0.98
R0586:Tns2	UTSW	15	102109585	splice site	probably benign
R0791:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0817:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0818:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0819:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R0820:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1451:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1454:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1455:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1487:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1510:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1579:Tns2	UTSW	15	102111210	missense	probably damaging	1.00
R1698:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1772:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1779:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1843:Tns2	UTSW	15	102113133	splice site	probably null
R1923:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1924:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1927:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R1980:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2051:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2087:Tns2	UTSW	15	102107119	missense	possibly damaging	0.70
R2100:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2103:Tns2	UTSW	15	102112665	critical splice acceptor site	probably null
R2105:Tns2	UTSW	15	102107506	missense	probably benign	0.27
R2224:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2225:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2227:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2252:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2253:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2290:Tns2	UTSW	15	102112023	missense	probably damaging	0.99
R2304:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2318:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2446:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2447:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2448:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2566:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2567:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2897:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R2898:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3159:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3160:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3162:Tns2	UTSW	15	102113336	missense	possibly damaging	0.88
R3196:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3237:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3426:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3427:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3428:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3695:Tns2	UTSW	15	102112749	missense	probably null
R3767:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R3911:Tns2	UTSW	15	102113837	critical splice donor site	probably null
R4113:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4157:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4394:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4395:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4396:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4439:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4441:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4537:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4538:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4541:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4599:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4600:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4602:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4773:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4774:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4775:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4776:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R4880:Tns2	UTSW	15	102112039	missense	probably damaging	0.98
R4989:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5014:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5058:Tns2	UTSW	15	102107860	missense	possibly damaging	0.68
R5253:Tns2	UTSW	15	102111453	missense	probably damaging	1.00
R5336:Tns2	UTSW	15	102111229	missense	probably damaging	1.00
R5351:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5452:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5453:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5629:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5630:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5631:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R5685:Tns2	UTSW	15	102107103	missense	probably benign	0.02
R5844:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6048:Tns2	UTSW	15	102111411	missense	probably damaging	1.00
R6067:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6079:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6130:Tns2	UTSW	15	102111241	missense	probably damaging	1.00
R6136:Tns2	UTSW	15	102107030	missense	probably damaging	1.00
R6138:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6199:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6210:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
R6426:Tns2	UTSW	15	102107037	missense	possibly damaging	0.65
R6544:Tns2	UTSW	15	102113834	missense	possibly damaging	0.93
R6594:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6596:Tns2	UTSW	15	102110559	missense	probably benign	0.00
R6734:Tns2	UTSW	15	102103116	missense	probably damaging	0.96
R7070:Tns2	UTSW	15	102104533	missense	possibly damaging	0.58
R7110:Tns2	UTSW	15	102105366	missense	probably damaging	0.99
R7410:Tns2	UTSW	15	102110526	missense	probably damaging	1.00
R7447:Tns2	UTSW	15	102110916	missense	probably damaging	1.00
R7751:Tns2	UTSW	15	102109728	missense	probably benign	0.02
R8052:Tns2	UTSW	15	102112845	missense	probably damaging	1.00
R8114:Tns2	UTSW	15	102111390	missense	probably benign	0.01
R8906:Tns2	UTSW	15	102111604	missense	probably damaging	1.00
R8964:Tns2	UTSW	15	102103118	missense	possibly damaging	0.73
R9192:Tns2	UTSW	15	102112981	missense	probably damaging	1.00
R9273:Tns2	UTSW	15	102113043	missense	probably damaging	1.00
R9307:Tns2	UTSW	15	102110561	missense	probably damaging	0.97
R9402:Tns2	UTSW	15	102113188	missense	probably damaging	0.99
U15987:Tns2	UTSW	15	102108934	missense	probably damaging	1.00
X0009:Tns2	UTSW	15	102112465	missense	possibly damaging	0.94
X0026:Tns2	UTSW	15	102110502	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGGGAGGAGTTGACCCAG -3'
(R):5'- TTGCCTGTCTCTAGAGCCTGAG -3'

Sequencing Primer
(F):5'- AGTTGACCCAGCCAAGGTGAC -3'
(R):5'- GTCTCTAGAGCCTGAGCCACAC -3'

Posted On

2019-05-13