Incidental Mutation 'R7061:Cpox'
ID548290
Institutional Source Beutler Lab
Gene Symbol Cpox
Ensembl Gene ENSMUSG00000022742
Gene Namecoproporphyrinogen oxidase
Synonymsnct, Cpo, cac, clone 560
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location58670292-58717636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58670860 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 145 (I145V)
Ref Sequence ENSEMBL: ENSMUSP00000055455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060077
AA Change: I145V

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000055455
Gene: ENSMUSG00000022742
AA Change: I145V

DomainStartEndE-ValueType
low complexity region 57 81 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:Coprogen_oxidas 140 442 7.6e-142 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the sixth enzyme of the heme biosynthetic pathway. The encoded enzyme is soluble and found in the intermembrane space of mitochondria. This enzyme catalyzes the stepwise oxidative decarboxylation of coproporphyrinogen III to protoporphyrinogen IX, a precursor of heme. Defects in this gene are a cause of hereditary coproporphyria (HCP).[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a spontaneous allele develop cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Cpox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Cpox APN 16 58674424 missense possibly damaging 0.87
IGL03031:Cpox APN 16 58672560 missense probably damaging 1.00
IGL03034:Cpox APN 16 58675355 missense probably damaging 0.98
scraggy UTSW 16 58670935 missense probably damaging 1.00
R0413:Cpox UTSW 16 58670869 missense possibly damaging 0.52
R0523:Cpox UTSW 16 58675245 nonsense probably null
R0551:Cpox UTSW 16 58675390 missense probably benign 0.11
R2064:Cpox UTSW 16 58674409 missense probably benign 0.36
R4651:Cpox UTSW 16 58670687 missense possibly damaging 0.92
R4701:Cpox UTSW 16 58677969 nonsense probably null
R4782:Cpox UTSW 16 58672623 missense probably damaging 1.00
R5285:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5287:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5313:Cpox UTSW 16 58677948 nonsense probably null
R5346:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5354:Cpox UTSW 16 58670842 missense probably damaging 0.99
R5404:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5476:Cpox UTSW 16 58678725 missense probably damaging 0.99
R5853:Cpox UTSW 16 58675417 missense probably damaging 0.99
R6026:Cpox UTSW 16 58670935 missense probably damaging 1.00
R7059:Cpox UTSW 16 58670927 missense probably damaging 1.00
R7606:Cpox UTSW 16 58674449 missense probably benign 0.16
R8753:Cpox UTSW 16 58678028 missense probably damaging 1.00
R8779:Cpox UTSW 16 58670866 missense probably damaging 1.00
R8793:Cpox UTSW 16 58673345 missense probably damaging 1.00
RF059:Cpox UTSW 16 58670767 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTGCAGGATCGGATTTGC -3'
(R):5'- GTCCCTTCTGACAGATCACC -3'

Sequencing Primer
(F):5'- AGGATCGGATTTGCCCAGTC -3'
(R):5'- CCTAAACTGCAACTGGTG -3'
Posted On2019-05-13