Mutagenetix > Incidental Mutations

Incidental Mutation 'R7061:Dopey2'

548291

Institutional Source

Beutler Lab

Gene Symbol

Dopey2

Ensembl Gene

ENSMUSG00000022946

Gene Name

dopey family member 2

Synonyms

0610038M01Rik, 2610510B01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7061 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93711904-93810590 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 93762063 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 448 (A448S)

Ref Sequence

ENSEMBL: ENSMUSP00000154771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156]

Predicted Effect

probably benign
Transcript: ENSMUST00000045004
AA Change: A566S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: A566S

Domain	Start	End	E-Value	Type
Pfam:Dopey_N	11	308	3.9e-104	PFAM
low complexity region	651	666	N/A	INTRINSIC
low complexity region	709	719	N/A	INTRINSIC
low complexity region	747	759	N/A	INTRINSIC
low complexity region	1186	1199	N/A	INTRINSIC
low complexity region	1436	1451	N/A	INTRINSIC
low complexity region	1893	1908	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226215

Predicted Effect

probably benign
Transcript: ENSMUST00000226836

Predicted Effect

probably benign
Transcript: ENSMUST00000227156
AA Change: A448S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (68/69)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,545,065	M660T	probably benign	Het
Aard	G	A	15: 52,040,221	M13I	probably benign	Het
Abcb5	A	C	12: 118,877,774	Y979D	probably damaging	Het
Adgrb1	G	C	15: 74,569,881	V4L	probably benign	Het
Ap3b2	C	T	7: 81,461,009	R1006Q	unknown	Het
Bpifa6	A	T	2: 153,992,316	T343S	probably benign	Het
Celsr3	T	A	9: 108,847,594	C2957*	probably null	Het
Chd6	G	A	2: 161,025,965	Q428*	probably null	Het
Col5a1	C	A	2: 28,025,678	C191*	probably null	Het
Cpox	A	G	16: 58,670,860	I145V	possibly damaging	Het
Csnk2a1	C	T	2: 152,274,171	R268C	probably benign	Het
Dclk2	A	G	3: 86,831,731		probably null	Het
Dennd5a	T	C	7: 109,905,179	E909G	probably benign	Het
Depdc1a	T	A	3: 159,522,852	S414T	possibly damaging	Het
Dock5	A	G	14: 67,770,254	F1502S	probably damaging	Het
Dsg1c	C	A	18: 20,277,009	N511K	probably benign	Het
Epc2	G	T	2: 49,535,322	R108L	probably damaging	Het
Erp44	T	A	4: 48,219,375	I147F	probably benign	Het
Evc	T	C	5: 37,319,102	T368A	possibly damaging	Het
Fbxo41	G	T	6: 85,475,466	R738S	probably benign	Het
Fli1	T	C	9: 32,424,222	T305A	probably damaging	Het
Gm4969	A	T	7: 19,100,128		probably benign	Het
Gm8897	T	C	5: 11,419,104	V74A	possibly damaging	Het
Grk5	A	G	19: 61,046,092	T93A	probably benign	Het
Grm2	A	T	9: 106,651,225	N153K	probably damaging	Het
Helz	A	G	11: 107,649,177	T1007A	possibly damaging	Het
Helz2	A	G	2: 181,240,514	L162P	probably damaging	Het
Hmgcr	T	A	13: 96,666,148	Q81L	possibly damaging	Het
Hnrnpu	T	C	1: 178,336,126	K218E	unknown	Het
Hydin	A	T	8: 110,603,288	I4885F	possibly damaging	Het
Ibsp	A	G	5: 104,309,902		probably null	Het
Igfals	T	C	17: 24,880,307	L124P	probably damaging	Het
Il24	T	A	1: 130,883,371	H142L	possibly damaging	Het
Kcnh2	A	T	5: 24,331,922	H221Q	probably benign	Het
Man1a	A	G	10: 53,920,235	S454P	probably damaging	Het
Mfsd4b1	C	T	10: 40,003,386	V172M	possibly damaging	Het
Mical2	T	A	7: 112,346,801	I763K	probably benign	Het
Mybpc3	A	G	2: 91,125,404	I594M	possibly damaging	Het
Neo1	T	A	9: 58,990,441	R77S	possibly damaging	Het
Nlrp6	A	G	7: 140,922,867	I265M	probably benign	Het
Olfr1350	A	G	7: 6,570,783	Y264C	probably damaging	Het
Olfr669	T	C	7: 104,938,676	L50P	probably damaging	Het
Olfr877	T	A	9: 37,855,646	V276D	possibly damaging	Het
Pcdhgb5	C	A	18: 37,731,923	P257Q	probably benign	Het
Phactr1	A	G	13: 43,132,981	D586G	probably damaging	Het
Pkn3	T	A	2: 30,083,536		probably null	Het
Prob1	A	T	18: 35,654,500	S234T	probably benign	Het
Rab14	A	T	2: 35,183,417	L131*	probably null	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rhebl1	A	G	15: 98,879,283	L103P	probably damaging	Het
Rnf10	G	T	5: 115,257,090	F146L	probably damaging	Het
Rrbp1	T	C	2: 143,989,167	K360R	possibly damaging	Het
Slc6a9	C	T	4: 117,868,064	T575I	probably benign	Het
Smo	A	G	6: 29,760,230	H776R	probably damaging	Het
Tns2	A	G	15: 102,104,479	M1V	probably null	Het
Ttn	C	A	2: 76,894,692		probably benign	Het
Ugt3a1	A	T	15: 9,306,154	M130L	probably benign	Het
Urb2	C	T	8: 124,028,297	H248Y	probably benign	Het
Vit	A	T	17: 78,625,156	N564I	probably damaging	Het
Vmn1r60	A	T	7: 5,544,311	Y263*	probably null	Het
Vmn2r16	A	T	5: 109,363,754	Y609F	probably damaging	Het
Xpo7	T	C	14: 70,671,072	I876V	probably benign	Het
Zfp442	A	G	2: 150,408,017	I655T	probably benign	Het
Zfp574	T	A	7: 25,080,197	C215S	possibly damaging	Het
Zfp608	T	C	18: 54,987,997	T173A	probably benign	Het
Zfp69	A	T	4: 120,931,401	V239D	possibly damaging	Het

Other mutations in Dopey2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Dopey2	APN	16	93800026	unclassified	probably benign
IGL00492:Dopey2	APN	16	93780782	missense	probably benign	0.00
IGL00753:Dopey2	APN	16	93769624	missense	probably benign
IGL00832:Dopey2	APN	16	93763401	missense	probably benign	0.01
IGL00939:Dopey2	APN	16	93774083	missense	possibly damaging	0.83
IGL01019:Dopey2	APN	16	93810229	missense	probably benign	0.32
IGL01288:Dopey2	APN	16	93739293	missense	possibly damaging	0.78
IGL01505:Dopey2	APN	16	93757116	missense	possibly damaging	0.87
IGL01535:Dopey2	APN	16	93769958	nonsense	probably null
IGL01696:Dopey2	APN	16	93770240	missense	probably benign	0.00
IGL02077:Dopey2	APN	16	93780760	missense	probably damaging	0.96
IGL02163:Dopey2	APN	16	93762427	missense	possibly damaging	0.48
IGL02234:Dopey2	APN	16	93752151	missense	probably benign
IGL02302:Dopey2	APN	16	93810117	missense	probably benign	0.08
IGL02485:Dopey2	APN	16	93770822	missense	probably damaging	1.00
IGL02563:Dopey2	APN	16	93777405	missense	probably damaging	0.99
IGL02733:Dopey2	APN	16	93739191	missense	possibly damaging	0.80
IGL02792:Dopey2	APN	16	93801572	missense	possibly damaging	0.75
IGL02941:Dopey2	APN	16	93755473	missense	probably benign	0.09
IGL03143:Dopey2	APN	16	93759655	missense	probably benign
PIT4519001:Dopey2	UTSW	16	93762054	missense	probably benign
R0320:Dopey2	UTSW	16	93810147	missense	probably benign	0.02
R0499:Dopey2	UTSW	16	93770437	missense	probably benign	0.00
R0501:Dopey2	UTSW	16	93752862	missense	probably benign	0.00
R0534:Dopey2	UTSW	16	93762505	missense	probably benign	0.04
R0583:Dopey2	UTSW	16	93755486	missense	probably benign	0.30
R0626:Dopey2	UTSW	16	93763956	missense	probably damaging	1.00
R0724:Dopey2	UTSW	16	93762325	missense	probably benign	0.01
R0907:Dopey2	UTSW	16	93801593	missense	probably damaging	1.00
R1263:Dopey2	UTSW	16	93777386	missense	probably benign
R1378:Dopey2	UTSW	16	93770392	missense	probably benign
R1572:Dopey2	UTSW	16	93770153	missense	probably damaging	1.00
R1604:Dopey2	UTSW	16	93762570	missense	probably benign
R1642:Dopey2	UTSW	16	93762315	missense	probably benign	0.00
R1668:Dopey2	UTSW	16	93765516	missense	probably damaging	1.00
R1669:Dopey2	UTSW	16	93769660	missense	probably damaging	1.00
R1702:Dopey2	UTSW	16	93747621	missense	possibly damaging	0.47
R1711:Dopey2	UTSW	16	93799926	missense	probably damaging	1.00
R1917:Dopey2	UTSW	16	93716262	missense	probably damaging	1.00
R1968:Dopey2	UTSW	16	93782419	missense	probably damaging	1.00
R1988:Dopey2	UTSW	16	93766173	missense	probably damaging	1.00
R2029:Dopey2	UTSW	16	93769435	missense	probably benign	0.36
R2139:Dopey2	UTSW	16	93771007	missense	possibly damaging	0.78
R2355:Dopey2	UTSW	16	93770677	missense	probably damaging	1.00
R3609:Dopey2	UTSW	16	93739332	missense	probably damaging	1.00
R3792:Dopey2	UTSW	16	93771846	missense	possibly damaging	0.54
R4364:Dopey2	UTSW	16	93770924	missense	probably benign	0.00
R4380:Dopey2	UTSW	16	93716232	missense	possibly damaging	0.53
R4455:Dopey2	UTSW	16	93766215	missense	probably damaging	1.00
R4779:Dopey2	UTSW	16	93757081	missense	probably damaging	1.00
R4820:Dopey2	UTSW	16	93793090	missense	probably benign	0.00
R4834:Dopey2	UTSW	16	93740004	start codon destroyed	probably null	0.70
R4866:Dopey2	UTSW	16	93763430	critical splice donor site	probably null
R4882:Dopey2	UTSW	16	93752914	missense	possibly damaging	0.95
R4900:Dopey2	UTSW	16	93763430	critical splice donor site	probably null
R5153:Dopey2	UTSW	16	93774003	missense	probably damaging	0.98
R5176:Dopey2	UTSW	16	93740043	missense	probably damaging	1.00
R5206:Dopey2	UTSW	16	93801584	missense	probably damaging	1.00
R5320:Dopey2	UTSW	16	93739986	missense	probably damaging	1.00
R5361:Dopey2	UTSW	16	93770504	missense	probably damaging	1.00
R5380:Dopey2	UTSW	16	93763410	missense	probably damaging	0.96
R5476:Dopey2	UTSW	16	93773913	splice site	probably null
R5502:Dopey2	UTSW	16	93793226	missense	probably benign	0.00
R5543:Dopey2	UTSW	16	93798920	missense	probably damaging	0.98
R5557:Dopey2	UTSW	16	93763931	missense	probably damaging	0.96
R5901:Dopey2	UTSW	16	93769751	missense	possibly damaging	0.88
R5907:Dopey2	UTSW	16	93801581	missense	probably damaging	1.00
R6174:Dopey2	UTSW	16	93766222	missense	probably damaging	1.00
R6256:Dopey2	UTSW	16	93807214	missense	possibly damaging	0.94
R6383:Dopey2	UTSW	16	93782248	missense	possibly damaging	0.76
R6525:Dopey2	UTSW	16	93809416	missense	probably damaging	1.00
R6554:Dopey2	UTSW	16	93760458	missense	probably benign	0.22
R6823:Dopey2	UTSW	16	93755485	missense	possibly damaging	0.75
R7036:Dopey2	UTSW	16	93777490	missense	probably benign	0.01
R7058:Dopey2	UTSW	16	93776990	missense	probably benign	0.00
R7209:Dopey2	UTSW	16	93769845	missense	probably benign
R7214:Dopey2	UTSW	16	93810135	missense	possibly damaging	0.69
R7232:Dopey2	UTSW	16	93760485	critical splice donor site	probably null
R7255:Dopey2	UTSW	16	93770146	missense	probably damaging	1.00
R7335:Dopey2	UTSW	16	93747508	missense	probably benign	0.04
R7535:Dopey2	UTSW	16	93806361	missense	probably damaging	1.00
R7700:Dopey2	UTSW	16	93798761	splice site	probably null
R7763:Dopey2	UTSW	16	93755514	missense	probably benign	0.00
R7814:Dopey2	UTSW	16	93799971	missense	probably damaging	1.00
R7839:Dopey2	UTSW	16	93763941	missense	probably damaging	1.00
R7862:Dopey2	UTSW	16	93749963	missense	probably damaging	1.00
R7894:Dopey2	UTSW	16	93810204	missense	probably benign	0.01
R7952:Dopey2	UTSW	16	93749960	missense	possibly damaging	0.93
R7956:Dopey2	UTSW	16	93771028	critical splice donor site	probably null
R8033:Dopey2	UTSW	16	93769483	missense	probably benign
R8061:Dopey2	UTSW	16	93749996	missense	probably damaging	1.00
R8067:Dopey2	UTSW	16	93765448	nonsense	probably null
R8146:Dopey2	UTSW	16	93749939	missense	possibly damaging	0.95
R8184:Dopey2	UTSW	16	93776993	missense	probably benign	0.13
R8221:Dopey2	UTSW	16	93749959	missense	probably benign	0.01
R8263:Dopey2	UTSW	16	93762195	missense	possibly damaging	0.87
R8329:Dopey2	UTSW	16	93771787	missense	probably damaging	1.00
R8555:Dopey2	UTSW	16	93771810	missense	probably damaging	1.00
R8683:Dopey2	UTSW	16	93771811	missense	probably damaging	0.98
R8683:Dopey2	UTSW	16	93773921	missense	probably benign
Z1088:Dopey2	UTSW	16	93763326	missense	probably benign	0.00
Z1176:Dopey2	UTSW	16	93769581	missense	probably benign	0.00
Z1176:Dopey2	UTSW	16	93803546	missense	probably damaging	1.00
Z1176:Dopey2	UTSW	16	93807868	missense	possibly damaging	0.82
Z1177:Dopey2	UTSW	16	93763895	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTAAGTGTCTTTCCAGGCTG -3'
(R):5'- AATGAGCTCCTGGATGCAGAG -3'

Sequencing Primer
(F):5'- TTTCCAGGCTGGCCATCG -3'
(R):5'- AGAAATGTCGCCTGCATGGTC -3'

Posted On

2019-05-13