Incidental Mutation 'R7061:Igfals'
ID548292
Institutional Source Beutler Lab
Gene Symbol Igfals
Ensembl Gene ENSMUSG00000046070
Gene Nameinsulin-like growth factor binding protein, acid labile subunit
SynonymsALS, Albs
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24878770-24882008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24880307 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 124 (L124P)
Ref Sequence ENSEMBL: ENSMUSP00000060169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044252] [ENSMUST00000050714]
Predicted Effect probably benign
Transcript: ENSMUST00000044252
SMART Domains Protein: ENSMUSP00000049319
Gene: ENSMUSG00000039183

DomainStartEndE-ValueType
Pfam:ParA 16 267 3.2e-99 PFAM
Pfam:ArsA_ATPase 19 66 1.7e-8 PFAM
Pfam:AAA_31 19 79 1.5e-8 PFAM
Pfam:MipZ 19 155 2.1e-10 PFAM
Pfam:CbiA 21 199 2.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000050714
AA Change: L124P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060169
Gene: ENSMUSG00000046070
AA Change: L124P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 40 78 9.37e-10 SMART
LRR 77 96 1.62e1 SMART
LRR 97 120 1.41e1 SMART
LRR_TYP 121 144 6.78e-3 SMART
LRR 145 168 1.03e1 SMART
LRR_TYP 169 192 1.1e-2 SMART
LRR 193 216 2.17e-1 SMART
LRR_TYP 217 240 2.4e-3 SMART
LRR_TYP 241 264 1.82e-3 SMART
LRR 265 288 5.72e-1 SMART
LRR_TYP 289 312 6.23e-2 SMART
LRR_TYP 313 336 6.32e-3 SMART
LRR_TYP 337 360 2.2e-2 SMART
LRR 361 384 1.89e-1 SMART
LRR 385 408 3.87e1 SMART
LRR 409 432 2.67e-1 SMART
LRR_TYP 433 456 1.06e-4 SMART
LRR_TYP 457 480 6.78e-3 SMART
LRR 481 504 1.09e2 SMART
LRR 505 530 2.68e1 SMART
LRRCT 535 582 5.11e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serum protein that binds insulin-like growth factors, increasing their half-life and their vascular localization. Production of the encoded protein, which contains twenty leucine-rich repeats, is stimulated by growth hormone. Defects in this gene are a cause of acid-labile subunit deficiency, which maifests itself in a delayed and slow puberty. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene gain weight more slowly after birth and display less growth in long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Igfals
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Igfals APN 17 24881660 missense probably benign 0.08
IGL01796:Igfals APN 17 24880082 missense probably damaging 0.96
IGL02448:Igfals APN 17 24880187 missense probably damaging 1.00
R1022:Igfals UTSW 17 24880483 missense probably damaging 0.99
R1024:Igfals UTSW 17 24880483 missense probably damaging 0.99
R1127:Igfals UTSW 17 24880481 missense probably damaging 1.00
R1653:Igfals UTSW 17 24881078 missense probably benign 0.00
R1827:Igfals UTSW 17 24880304 missense probably benign 0.20
R3872:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R3873:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R3874:Igfals UTSW 17 24881605 missense possibly damaging 0.88
R4278:Igfals UTSW 17 24881217 missense probably benign 0.01
R5360:Igfals UTSW 17 24880093 missense probably benign 0.00
R5417:Igfals UTSW 17 24880316 missense probably damaging 1.00
R5654:Igfals UTSW 17 24881465 missense probably benign 0.23
R6261:Igfals UTSW 17 24881365 missense possibly damaging 0.88
R7223:Igfals UTSW 17 24881234 missense probably damaging 1.00
R7484:Igfals UTSW 17 24879988 missense possibly damaging 0.95
R7699:Igfals UTSW 17 24880574 missense probably damaging 1.00
R7700:Igfals UTSW 17 24880574 missense probably damaging 1.00
R8197:Igfals UTSW 17 24880304 missense probably benign 0.01
R8707:Igfals UTSW 17 24880211 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GATGACTACACAGATGAGCTCAGC -3'
(R):5'- ACTAGGCTGTTCCAACCCAG -3'

Sequencing Primer
(F):5'- CACAGATGAGCTCAGCGTCTTTTG -3'
(R):5'- ACCCAGGTTGAGGTCCCAAAG -3'
Posted On2019-05-13