Incidental Mutation 'R7062:Astn1'
ID548303
Institutional Source Beutler Lab
Gene Symbol Astn1
Ensembl Gene ENSMUSG00000026587
Gene Nameastrotactin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7062 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location158362273-158691781 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 158688511 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000046110] [ENSMUST00000192821] [ENSMUST00000193042] [ENSMUST00000193042]
Predicted Effect probably null
Transcript: ENSMUST00000046110
SMART Domains Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000046110
SMART Domains Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192821
SMART Domains Protein: ENSMUSP00000141260
Gene: ENSMUSG00000026587

DomainStartEndE-ValueType
FN3 46 158 2.8e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193042
SMART Domains Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193042
SMART Domains Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,599,146 D1370V probably damaging Het
Ackr1 A T 1: 173,332,115 I279N possibly damaging Het
Adcy10 A G 1: 165,538,522 H536R probably benign Het
Adgrb3 T C 1: 25,826,085 T226A possibly damaging Het
Apol10b T A 15: 77,585,273 M235L probably benign Het
Arhgap44 T C 11: 65,011,932 T570A probably benign Het
Camsap3 A G 8: 3,607,834 probably benign Het
Ccdc73 C T 2: 104,951,878 A193V probably damaging Het
Ccl20 G A 1: 83,117,814 C32Y probably damaging Het
Cdk11b A G 4: 155,626,811 E16G probably damaging Het
Celsr2 T A 3: 108,402,510 N1591I possibly damaging Het
Col5a2 T C 1: 45,417,625 E306G probably benign Het
Cpa1 C T 6: 30,640,677 A106V probably benign Het
Ctdspl G A 9: 119,037,470 R199H probably damaging Het
Cyfip2 G A 11: 46,260,832 P547S probably damaging Het
Cyp2c37 A T 19: 39,995,546 probably null Het
Dnajc16 A G 4: 141,766,690 F549L probably damaging Het
Dnm3 T A 1: 162,134,491 K50* probably null Het
Eci1 C T 17: 24,426,740 probably benign Het
Eif2b4 C T 5: 31,192,831 C49Y probably benign Het
Emc3 A T 6: 113,522,796 I56N probably damaging Het
Enthd1 A G 15: 80,452,544 L563P probably damaging Het
Ercc4 T A 16: 13,132,947 I635K probably damaging Het
Espl1 A C 15: 102,298,896 N265T probably benign Het
Fads2 T C 19: 10,065,598 probably null Het
Fam186a G A 15: 99,933,640 probably benign Het
Fastkd1 A T 2: 69,704,322 I368K possibly damaging Het
Fat1 G A 8: 44,950,216 M1I probably null Het
Foxj1 T C 11: 116,331,993 E328G probably benign Het
Gfod2 T C 8: 105,722,876 probably benign Het
Gm6525 C T 3: 84,174,891 R40C probably benign Het
Gna12 G A 5: 140,785,485 T144I probably benign Het
Ighv9-3 T C 12: 114,141,092 M11V probably benign Het
Kcnj14 T C 7: 45,817,890 Y344C probably damaging Het
Lrrc63 A T 14: 75,086,297 S496T probably benign Het
Ltn1 T C 16: 87,427,603 T78A probably damaging Het
Matr3 T A 18: 35,579,019 probably null Het
Mcpt4 A G 14: 56,060,668 M142T probably benign Het
Mroh7 A G 4: 106,683,980 F1154S probably damaging Het
Mrpl1 G T 5: 96,213,791 L12F probably benign Het
Myo3b G A 2: 70,217,157 V308I probably benign Het
Nfasc A G 1: 132,601,969 probably null Het
Npc1l1 T A 11: 6,217,807 M995L probably benign Het
Nvl A G 1: 181,112,334 I617T probably benign Het
Oas1h C A 5: 120,861,465 probably benign Het
Oasl2 T A 5: 114,911,091 Y197* probably null Het
Olfr1156 T C 2: 87,950,224 E3G probably benign Het
Olfr262 T C 19: 12,240,725 N312S probably benign Het
Olfr495 C T 7: 108,395,830 R237* probably null Het
Olfr598 T C 7: 103,329,086 V200A probably benign Het
Olfr728 A G 14: 50,140,450 L63P probably damaging Het
Olfr955 A T 9: 39,470,057 I223N probably benign Het
Orc6 T C 8: 85,302,908 V27A probably damaging Het
Parp4 A T 14: 56,614,759 R799S possibly damaging Het
Pcdhga1 C A 18: 37,825,077 S826R probably damaging Het
Phldb1 T C 9: 44,696,135 R1258G probably damaging Het
Ppfia1 T C 7: 144,552,473 S21G probably benign Het
Ppp1r18 C A 17: 35,868,211 T326K probably damaging Het
Psg26 A G 7: 18,482,596 L106P probably damaging Het
Rabgap1l A T 1: 160,226,650 D265E probably benign Het
Rasgrp4 T C 7: 29,150,194 L554P possibly damaging Het
Rnf17 G T 14: 56,465,654 V621L probably benign Het
Sart3 T C 5: 113,745,602 K783R possibly damaging Het
Slc23a2 T A 2: 132,091,269 I90F probably damaging Het
Slc5a2 A T 7: 128,270,040 M331L probably damaging Het
Slc5a7 C G 17: 54,293,001 G128A probably damaging Het
Smcr8 A T 11: 60,780,354 Q776L probably damaging Het
Smpd4 T A 16: 17,640,971 D519E probably damaging Het
Smurf1 A T 5: 144,893,546 probably null Het
Spata18 T A 5: 73,659,293 N125K probably benign Het
Spice1 T A 16: 44,357,896 M94K probably damaging Het
Stard4 T C 18: 33,205,534 probably null Het
Stx17 A G 4: 48,140,442 D49G probably benign Het
Tbce T C 13: 14,019,795 D93G possibly damaging Het
Tbx21 T A 11: 97,098,893 D491V probably damaging Het
Tmbim4 G T 10: 120,208,826 probably benign Het
Tmem209 C T 6: 30,502,017 R62H probably damaging Het
Tmem237 A T 1: 59,119,612 probably null Het
Tmprss9 T C 10: 80,895,049 I803T probably benign Het
Trip4 C T 9: 65,885,010 A7T probably benign Het
Unc13a T C 8: 71,663,237 D107G probably benign Het
Uso1 C A 5: 92,192,740 Q672K possibly damaging Het
Washc2 T A 6: 116,219,988 N239K possibly damaging Het
Zfp661 A G 2: 127,577,120 C367R probably damaging Het
Znrf3 T A 11: 5,281,550 E558D probably damaging Het
Other mutations in Astn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Astn1 APN 1 158600319 missense possibly damaging 0.71
IGL01705:Astn1 APN 1 158504313 missense probably damaging 1.00
IGL01790:Astn1 APN 1 158580327 missense possibly damaging 0.70
IGL01962:Astn1 APN 1 158668631 missense probably damaging 1.00
IGL02000:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02119:Astn1 APN 1 158511154 intron probably benign
IGL02168:Astn1 APN 1 158609341 missense possibly damaging 0.93
IGL02239:Astn1 APN 1 158664130 critical splice donor site probably null
IGL02271:Astn1 APN 1 158510950 splice site probably benign
IGL02307:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02504:Astn1 APN 1 158502408 missense probably damaging 1.00
IGL02552:Astn1 APN 1 158505395 missense possibly damaging 0.90
IGL02903:Astn1 APN 1 158688550 missense probably damaging 0.99
IGL03003:Astn1 APN 1 158612395 missense probably benign 0.00
IGL03007:Astn1 APN 1 158668623 splice site probably benign
IGL03354:Astn1 APN 1 158688604 missense probably damaging 1.00
PIT4366001:Astn1 UTSW 1 158597209 missense probably benign 0.20
PIT4366001:Astn1 UTSW 1 158597211 missense probably benign 0.23
R0024:Astn1 UTSW 1 158684215 missense probably damaging 0.99
R0050:Astn1 UTSW 1 158579724 splice site probably benign
R0099:Astn1 UTSW 1 158502151 missense probably damaging 1.00
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0365:Astn1 UTSW 1 158688548 missense probably damaging 1.00
R0416:Astn1 UTSW 1 158509891 missense probably damaging 1.00
R0531:Astn1 UTSW 1 158600389 missense probably damaging 0.99
R0735:Astn1 UTSW 1 158472389 missense possibly damaging 0.53
R0763:Astn1 UTSW 1 158509890 missense possibly damaging 0.93
R0899:Astn1 UTSW 1 158511109 nonsense probably null
R1027:Astn1 UTSW 1 158580279 missense probably damaging 1.00
R1160:Astn1 UTSW 1 158600365 missense possibly damaging 0.83
R1474:Astn1 UTSW 1 158502353 missense probably damaging 1.00
R1517:Astn1 UTSW 1 158579576 splice site probably benign
R1701:Astn1 UTSW 1 158504307 missense possibly damaging 0.54
R1764:Astn1 UTSW 1 158504251 missense probably benign 0.35
R1860:Astn1 UTSW 1 158601945 missense probably damaging 1.00
R1889:Astn1 UTSW 1 158505316 intron probably null
R1919:Astn1 UTSW 1 158509971 missense probably damaging 1.00
R2001:Astn1 UTSW 1 158520521 missense probably damaging 1.00
R2007:Astn1 UTSW 1 158609305 missense probably damaging 0.97
R2038:Astn1 UTSW 1 158657120 missense probably benign 0.29
R2044:Astn1 UTSW 1 158600502 missense possibly damaging 0.53
R2084:Astn1 UTSW 1 158472408 missense probably damaging 0.99
R2094:Astn1 UTSW 1 158667609 missense probably benign 0.02
R2163:Astn1 UTSW 1 158502150 missense probably damaging 0.99
R2211:Astn1 UTSW 1 158657306 missense probably benign 0.40
R2268:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2269:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2425:Astn1 UTSW 1 158579666 missense probably damaging 0.99
R2428:Astn1 UTSW 1 158612346 missense possibly damaging 0.66
R2980:Astn1 UTSW 1 158572951 critical splice acceptor site probably null
R3713:Astn1 UTSW 1 158667532 missense possibly damaging 0.83
R3745:Astn1 UTSW 1 158502060 missense probably damaging 1.00
R3926:Astn1 UTSW 1 158579657 missense possibly damaging 0.95
R4345:Astn1 UTSW 1 158502032 intron probably null
R4625:Astn1 UTSW 1 158580294 missense probably damaging 1.00
R4627:Astn1 UTSW 1 158502251 missense possibly damaging 0.55
R4970:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5112:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5257:Astn1 UTSW 1 158612532 missense probably damaging 1.00
R5292:Astn1 UTSW 1 158580363 critical splice donor site probably null
R5889:Astn1 UTSW 1 158600380 missense possibly damaging 0.93
R5909:Astn1 UTSW 1 158601937 missense probably damaging 1.00
R6020:Astn1 UTSW 1 158509993 missense probably damaging 1.00
R6349:Astn1 UTSW 1 158664121 nonsense probably null
R6481:Astn1 UTSW 1 158612462 missense probably benign 0.29
R6736:Astn1 UTSW 1 158511148 critical splice donor site probably null
R6833:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6834:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6860:Astn1 UTSW 1 158612472 missense probably damaging 1.00
R6874:Astn1 UTSW 1 158664074 nonsense probably null
R7133:Astn1 UTSW 1 158572987 missense probably damaging 1.00
R7355:Astn1 UTSW 1 158664276 intron probably null
R7402:Astn1 UTSW 1 158552855 intron probably benign
R7412:Astn1 UTSW 1 158502349 missense probably damaging 0.98
R7537:Astn1 UTSW 1 158505386 missense possibly damaging 0.84
R7537:Astn1 UTSW 1 158667638 splice site probably null
R7635:Astn1 UTSW 1 158667535 nonsense probably null
Z1088:Astn1 UTSW 1 158472497 missense possibly damaging 0.93
Z1088:Astn1 UTSW 1 158597206 missense possibly damaging 0.91
Z1088:Astn1 UTSW 1 158684096 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAACACTAGTTACTCATGGTCTC -3'
(R):5'- ACATGTCTTCCTGAGGTCCC -3'

Sequencing Primer
(F):5'- AGTTACTCATGGTCTCATTTTTACC -3'
(R):5'- TCTTCCTGAGGTCCCGACTGAG -3'
Posted On2019-05-13