Incidental Mutation 'R7062:Dnm3'
ID548305
Institutional Source Beutler Lab
Gene Symbol Dnm3
Ensembl Gene ENSMUSG00000040265
Gene Namedynamin 3
SynonymsB230343F03Rik, 9630020E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7062 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location161982453-162478034 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 162134491 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 50 (K50*)
Ref Sequence ENSEMBL: ENSMUSP00000124593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070330] [ENSMUST00000086074] [ENSMUST00000159763] [ENSMUST00000160665]
Predicted Effect probably null
Transcript: ENSMUST00000070330
AA Change: K579*
SMART Domains Protein: ENSMUSP00000064538
Gene: ENSMUSG00000040265
AA Change: K579*

DomainStartEndE-ValueType
DYNc 6 245 1.48e-182 SMART
PH 516 623 1.58e-11 SMART
GED 644 735 6.82e-33 SMART
low complexity region 738 751 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 799 812 N/A INTRINSIC
low complexity region 824 852 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000086074
AA Change: K579*
SMART Domains Protein: ENSMUSP00000083241
Gene: ENSMUSG00000040265
AA Change: K579*

DomainStartEndE-ValueType
DYNc 6 245 1.48e-182 SMART
PH 516 623 1.58e-11 SMART
GED 648 739 6.82e-33 SMART
low complexity region 742 755 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 828 856 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159763
AA Change: K50*
SMART Domains Protein: ENSMUSP00000125356
Gene: ENSMUSG00000040265
AA Change: K50*

DomainStartEndE-ValueType
PH 1 94 5.13e-2 SMART
GED 115 206 6.82e-33 SMART
low complexity region 209 222 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160665
AA Change: K50*
SMART Domains Protein: ENSMUSP00000124593
Gene: ENSMUSG00000040265
AA Change: K50*

DomainStartEndE-ValueType
PH 1 94 5.13e-2 SMART
GED 115 206 6.82e-33 SMART
low complexity region 209 222 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of guanosine triphosphate (GTP)-binding proteins that associate with microtubules and are involved in vesicular transport. The encoded protein functions in the development of megakaryocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,599,146 D1370V probably damaging Het
Ackr1 A T 1: 173,332,115 I279N possibly damaging Het
Adcy10 A G 1: 165,538,522 H536R probably benign Het
Adgrb3 T C 1: 25,826,085 T226A possibly damaging Het
Apol10b T A 15: 77,585,273 M235L probably benign Het
Arhgap44 T C 11: 65,011,932 T570A probably benign Het
Astn1 A G 1: 158,688,511 probably null Het
Camsap3 A G 8: 3,607,834 probably benign Het
Ccdc73 C T 2: 104,951,878 A193V probably damaging Het
Ccl20 G A 1: 83,117,814 C32Y probably damaging Het
Cdk11b A G 4: 155,626,811 E16G probably damaging Het
Celsr2 T A 3: 108,402,510 N1591I possibly damaging Het
Col5a2 T C 1: 45,417,625 E306G probably benign Het
Cpa1 C T 6: 30,640,677 A106V probably benign Het
Ctdspl G A 9: 119,037,470 R199H probably damaging Het
Cyfip2 G A 11: 46,260,832 P547S probably damaging Het
Cyp2c37 A T 19: 39,995,546 probably null Het
Dnajc16 A G 4: 141,766,690 F549L probably damaging Het
Eci1 C T 17: 24,426,740 probably benign Het
Eif2b4 C T 5: 31,192,831 C49Y probably benign Het
Emc3 A T 6: 113,522,796 I56N probably damaging Het
Enthd1 A G 15: 80,452,544 L563P probably damaging Het
Ercc4 T A 16: 13,132,947 I635K probably damaging Het
Espl1 A C 15: 102,298,896 N265T probably benign Het
Fads2 T C 19: 10,065,598 probably null Het
Fam186a G A 15: 99,933,640 probably benign Het
Fastkd1 A T 2: 69,704,322 I368K possibly damaging Het
Fat1 G A 8: 44,950,216 M1I probably null Het
Foxj1 T C 11: 116,331,993 E328G probably benign Het
Gfod2 T C 8: 105,722,876 probably benign Het
Gm6525 C T 3: 84,174,891 R40C probably benign Het
Gna12 G A 5: 140,785,485 T144I probably benign Het
Ighv9-3 T C 12: 114,141,092 M11V probably benign Het
Kcnj14 T C 7: 45,817,890 Y344C probably damaging Het
Lrrc63 A T 14: 75,086,297 S496T probably benign Het
Ltn1 T C 16: 87,427,603 T78A probably damaging Het
Matr3 T A 18: 35,579,019 probably null Het
Mcpt4 A G 14: 56,060,668 M142T probably benign Het
Mroh7 A G 4: 106,683,980 F1154S probably damaging Het
Mrpl1 G T 5: 96,213,791 L12F probably benign Het
Myo3b G A 2: 70,217,157 V308I probably benign Het
Nfasc A G 1: 132,601,969 probably null Het
Npc1l1 T A 11: 6,217,807 M995L probably benign Het
Nvl A G 1: 181,112,334 I617T probably benign Het
Oas1h C A 5: 120,861,465 probably benign Het
Oasl2 T A 5: 114,911,091 Y197* probably null Het
Olfr1156 T C 2: 87,950,224 E3G probably benign Het
Olfr262 T C 19: 12,240,725 N312S probably benign Het
Olfr495 C T 7: 108,395,830 R237* probably null Het
Olfr598 T C 7: 103,329,086 V200A probably benign Het
Olfr728 A G 14: 50,140,450 L63P probably damaging Het
Olfr955 A T 9: 39,470,057 I223N probably benign Het
Orc6 T C 8: 85,302,908 V27A probably damaging Het
Parp4 A T 14: 56,614,759 R799S possibly damaging Het
Pcdhga1 C A 18: 37,825,077 S826R probably damaging Het
Phldb1 T C 9: 44,696,135 R1258G probably damaging Het
Ppfia1 T C 7: 144,552,473 S21G probably benign Het
Ppp1r18 C A 17: 35,868,211 T326K probably damaging Het
Psg26 A G 7: 18,482,596 L106P probably damaging Het
Rabgap1l A T 1: 160,226,650 D265E probably benign Het
Rasgrp4 T C 7: 29,150,194 L554P possibly damaging Het
Rnf17 G T 14: 56,465,654 V621L probably benign Het
Sart3 T C 5: 113,745,602 K783R possibly damaging Het
Slc23a2 T A 2: 132,091,269 I90F probably damaging Het
Slc5a2 A T 7: 128,270,040 M331L probably damaging Het
Slc5a7 C G 17: 54,293,001 G128A probably damaging Het
Smcr8 A T 11: 60,780,354 Q776L probably damaging Het
Smpd4 T A 16: 17,640,971 D519E probably damaging Het
Smurf1 A T 5: 144,893,546 probably null Het
Spata18 T A 5: 73,659,293 N125K probably benign Het
Spice1 T A 16: 44,357,896 M94K probably damaging Het
Stard4 T C 18: 33,205,534 probably null Het
Stx17 A G 4: 48,140,442 D49G probably benign Het
Tbce T C 13: 14,019,795 D93G possibly damaging Het
Tbx21 T A 11: 97,098,893 D491V probably damaging Het
Tmbim4 G T 10: 120,208,826 probably benign Het
Tmem209 C T 6: 30,502,017 R62H probably damaging Het
Tmem237 A T 1: 59,119,612 probably null Het
Tmprss9 T C 10: 80,895,049 I803T probably benign Het
Trip4 C T 9: 65,885,010 A7T probably benign Het
Unc13a T C 8: 71,663,237 D107G probably benign Het
Uso1 C A 5: 92,192,740 Q672K possibly damaging Het
Washc2 T A 6: 116,219,988 N239K possibly damaging Het
Zfp661 A G 2: 127,577,120 C367R probably damaging Het
Znrf3 T A 11: 5,281,550 E558D probably damaging Het
Other mutations in Dnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Dnm3 APN 1 162011926 missense probably damaging 1.00
IGL02444:Dnm3 APN 1 162010875 missense possibly damaging 0.46
IGL02481:Dnm3 APN 1 162010902 missense probably damaging 0.99
IGL02623:Dnm3 APN 1 162355432 missense probably damaging 0.99
IGL03132:Dnm3 APN 1 162011105 critical splice acceptor site probably null
IGL03330:Dnm3 APN 1 162320991 missense probably benign 0.00
fever UTSW 1 162321127 splice site probably null
nobel UTSW 1 162477705 missense probably damaging 1.00
splotare UTSW 1 162320987 missense probably damaging 0.98
LCD18:Dnm3 UTSW 1 162406561 intron probably benign
R0066:Dnm3 UTSW 1 162407361 missense probably damaging 0.98
R0066:Dnm3 UTSW 1 162407361 missense probably damaging 0.98
R0240:Dnm3 UTSW 1 162353625 missense probably benign 0.00
R0240:Dnm3 UTSW 1 162353625 missense probably benign 0.00
R0968:Dnm3 UTSW 1 162019819 splice site probably benign
R1161:Dnm3 UTSW 1 162353574 missense probably benign 0.06
R1680:Dnm3 UTSW 1 162010976 missense probably benign 0.12
R1747:Dnm3 UTSW 1 162313584 missense probably damaging 1.00
R1881:Dnm3 UTSW 1 162477948 start gained probably benign
R1997:Dnm3 UTSW 1 162353712 missense possibly damaging 0.60
R2157:Dnm3 UTSW 1 162307893 missense possibly damaging 0.95
R2270:Dnm3 UTSW 1 162477789 missense probably damaging 1.00
R2897:Dnm3 UTSW 1 162286074 splice site probably benign
R3018:Dnm3 UTSW 1 162321759 nonsense probably null
R3851:Dnm3 UTSW 1 162321127 splice site probably null
R3861:Dnm3 UTSW 1 162311405 missense possibly damaging 0.79
R3930:Dnm3 UTSW 1 162084130 missense probably damaging 1.00
R4432:Dnm3 UTSW 1 161991997 intron probably benign
R5318:Dnm3 UTSW 1 162011807 nonsense probably null
R5361:Dnm3 UTSW 1 162010902 missense probably damaging 0.99
R5606:Dnm3 UTSW 1 162286018 missense probably damaging 0.99
R5783:Dnm3 UTSW 1 162355471 missense possibly damaging 0.70
R6019:Dnm3 UTSW 1 162134501 missense probably damaging 0.99
R6072:Dnm3 UTSW 1 162011068 small deletion probably benign
R6086:Dnm3 UTSW 1 162321033 missense probably damaging 0.99
R6110:Dnm3 UTSW 1 162011068 small deletion probably benign
R6158:Dnm3 UTSW 1 162320987 missense probably damaging 0.98
R6473:Dnm3 UTSW 1 162477705 missense probably damaging 1.00
R6499:Dnm3 UTSW 1 162313595 missense probably damaging 1.00
R6702:Dnm3 UTSW 1 162318687 missense probably benign 0.04
R6703:Dnm3 UTSW 1 162318687 missense probably benign 0.04
R6739:Dnm3 UTSW 1 162477783 missense probably damaging 0.99
R6811:Dnm3 UTSW 1 162321083 missense probably damaging 0.96
R6915:Dnm3 UTSW 1 162318397 splice site probably null
R6946:Dnm3 UTSW 1 162313655 missense possibly damaging 0.91
R7067:Dnm3 UTSW 1 162320971 missense probably damaging 1.00
R7071:Dnm3 UTSW 1 162019843 missense probably damaging 0.99
R7468:Dnm3 UTSW 1 162321629 splice site probably null
R7521:Dnm3 UTSW 1 162134544 missense probably damaging 1.00
R7583:Dnm3 UTSW 1 162477774 missense possibly damaging 0.93
R7667:Dnm3 UTSW 1 162011830 missense probably damaging 1.00
R7711:Dnm3 UTSW 1 161992053 missense possibly damaging 0.83
R7837:Dnm3 UTSW 1 161992050 missense possibly damaging 0.94
R7838:Dnm3 UTSW 1 161992050 missense possibly damaging 0.94
R7900:Dnm3 UTSW 1 162355371 missense probably benign 0.00
R7939:Dnm3 UTSW 1 162295596 missense possibly damaging 0.91
R8059:Dnm3 UTSW 1 162084139 missense probably damaging 1.00
R8123:Dnm3 UTSW 1 162011103 missense probably benign 0.01
R8246:Dnm3 UTSW 1 162307917 missense probably damaging 1.00
R8249:Dnm3 UTSW 1 162477743 nonsense probably null
R8511:Dnm3 UTSW 1 162286042 missense possibly damaging 0.69
R8900:Dnm3 UTSW 1 162307876 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGGACTTTTGAAGCCATAACCC -3'
(R):5'- ACTAGTGTGTGACAGTATCGAG -3'

Sequencing Primer
(F):5'- TTGCCTGTAATACCAACACTCGGG -3'
(R):5'- TGTGACAGTATCGAGGTAAAGTAATC -3'
Posted On2019-05-13