Incidental Mutation 'R7062:Myo3b'
ID 548310
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 045158-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7062 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70047501 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 308 (V308I)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: V336I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: V336I

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: V308I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: V308I

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,544,872 (GRCm39) D1370V probably damaging Het
Ackr1 A T 1: 173,159,682 (GRCm39) I279N possibly damaging Het
Adcy10 A G 1: 165,366,091 (GRCm39) H536R probably benign Het
Adgrb3 T C 1: 25,865,166 (GRCm39) T226A possibly damaging Het
Apol10b T A 15: 77,469,473 (GRCm39) M235L probably benign Het
Arhgap44 T C 11: 64,902,758 (GRCm39) T570A probably benign Het
Astn1 A G 1: 158,516,081 (GRCm39) probably null Het
Camsap3 A G 8: 3,657,834 (GRCm39) probably benign Het
Ccdc73 C T 2: 104,782,223 (GRCm39) A193V probably damaging Het
Ccl20 G A 1: 83,095,535 (GRCm39) C32Y probably damaging Het
Cdk11b A G 4: 155,711,268 (GRCm39) E16G probably damaging Het
Celsr2 T A 3: 108,309,826 (GRCm39) N1591I possibly damaging Het
Col5a2 T C 1: 45,456,785 (GRCm39) E306G probably benign Het
Cpa1 C T 6: 30,640,676 (GRCm39) A106V probably benign Het
Ctdspl G A 9: 118,866,538 (GRCm39) R199H probably damaging Het
Cyfip2 G A 11: 46,151,659 (GRCm39) P547S probably damaging Het
Cyp2c37 A T 19: 39,983,990 (GRCm39) probably null Het
Dnajc16 A G 4: 141,494,001 (GRCm39) F549L probably damaging Het
Dnm3 T A 1: 161,962,060 (GRCm39) K50* probably null Het
Eci1 C T 17: 24,645,714 (GRCm39) probably benign Het
Eif2b4 C T 5: 31,350,175 (GRCm39) C49Y probably benign Het
Emc3 A T 6: 113,499,757 (GRCm39) I56N probably damaging Het
Enthd1 A G 15: 80,336,745 (GRCm39) L563P probably damaging Het
Ercc4 T A 16: 12,950,811 (GRCm39) I635K probably damaging Het
Espl1 A C 15: 102,207,331 (GRCm39) N265T probably benign Het
Fads2 T C 19: 10,042,962 (GRCm39) probably null Het
Fam186a G A 15: 99,831,521 (GRCm39) probably benign Het
Fastkd1 A T 2: 69,534,666 (GRCm39) I368K possibly damaging Het
Fat1 G A 8: 45,403,253 (GRCm39) M1I probably null Het
Foxj1 T C 11: 116,222,819 (GRCm39) E328G probably benign Het
Gfod2 T C 8: 106,449,508 (GRCm39) probably benign Het
Gm6525 C T 3: 84,082,198 (GRCm39) R40C probably benign Het
Gna12 G A 5: 140,771,240 (GRCm39) T144I probably benign Het
Ighv9-3 T C 12: 114,104,712 (GRCm39) M11V probably benign Het
Kcnj14 T C 7: 45,467,314 (GRCm39) Y344C probably damaging Het
Lrrc63 A T 14: 75,323,737 (GRCm39) S496T probably benign Het
Ltn1 T C 16: 87,224,491 (GRCm39) T78A probably damaging Het
Matr3 T A 18: 35,712,072 (GRCm39) probably null Het
Mcpt4 A G 14: 56,298,125 (GRCm39) M142T probably benign Het
Mroh7 A G 4: 106,541,177 (GRCm39) F1154S probably damaging Het
Mrpl1 G T 5: 96,361,650 (GRCm39) L12F probably benign Het
Nfasc A G 1: 132,529,707 (GRCm39) probably null Het
Npc1l1 T A 11: 6,167,807 (GRCm39) M995L probably benign Het
Nvl A G 1: 180,939,899 (GRCm39) I617T probably benign Het
Oas1h C A 5: 120,999,528 (GRCm39) probably benign Het
Oasl2 T A 5: 115,049,152 (GRCm39) Y197* probably null Het
Or4k1 A G 14: 50,377,907 (GRCm39) L63P probably damaging Het
Or52ab7 T C 7: 102,978,293 (GRCm39) V200A probably benign Het
Or5an1c T C 19: 12,218,089 (GRCm39) N312S probably benign Het
Or5l13 T C 2: 87,780,568 (GRCm39) E3G probably benign Het
Or5p70 C T 7: 107,995,037 (GRCm39) R237* probably null Het
Or8g35 A T 9: 39,381,353 (GRCm39) I223N probably benign Het
Orc6 T C 8: 86,029,537 (GRCm39) V27A probably damaging Het
Parp4 A T 14: 56,852,216 (GRCm39) R799S possibly damaging Het
Pcdhga1 C A 18: 37,958,130 (GRCm39) S826R probably damaging Het
Phldb1 T C 9: 44,607,432 (GRCm39) R1258G probably damaging Het
Ppfia1 T C 7: 144,106,210 (GRCm39) S21G probably benign Het
Ppp1r18 C A 17: 36,179,103 (GRCm39) T326K probably damaging Het
Psg26 A G 7: 18,216,521 (GRCm39) L106P probably damaging Het
Rabgap1l A T 1: 160,054,220 (GRCm39) D265E probably benign Het
Rasgrp4 T C 7: 28,849,619 (GRCm39) L554P possibly damaging Het
Rnf17 G T 14: 56,703,111 (GRCm39) V621L probably benign Het
Sart3 T C 5: 113,883,663 (GRCm39) K783R possibly damaging Het
Slc23a2 T A 2: 131,933,189 (GRCm39) I90F probably damaging Het
Slc5a2 A T 7: 127,869,212 (GRCm39) M331L probably damaging Het
Slc5a7 C G 17: 54,600,029 (GRCm39) G128A probably damaging Het
Smcr8 A T 11: 60,671,180 (GRCm39) Q776L probably damaging Het
Smpd4 T A 16: 17,458,835 (GRCm39) D519E probably damaging Het
Smurf1 A T 5: 144,830,356 (GRCm39) probably null Het
Spata18 T A 5: 73,816,636 (GRCm39) N125K probably benign Het
Spice1 T A 16: 44,178,259 (GRCm39) M94K probably damaging Het
Stard4 T C 18: 33,338,587 (GRCm39) probably null Het
Stx17 A G 4: 48,140,442 (GRCm39) D49G probably benign Het
Tbce T C 13: 14,194,380 (GRCm39) D93G possibly damaging Het
Tbx21 T A 11: 96,989,719 (GRCm39) D491V probably damaging Het
Tmbim4 G T 10: 120,044,731 (GRCm39) probably benign Het
Tmem209 C T 6: 30,502,016 (GRCm39) R62H probably damaging Het
Tmem237 A T 1: 59,158,771 (GRCm39) probably null Het
Tmprss9 T C 10: 80,730,883 (GRCm39) I803T probably benign Het
Trip4 C T 9: 65,792,292 (GRCm39) A7T probably benign Het
Unc13a T C 8: 72,115,881 (GRCm39) D107G probably benign Het
Uso1 C A 5: 92,340,599 (GRCm39) Q672K possibly damaging Het
Washc2 T A 6: 116,196,949 (GRCm39) N239K possibly damaging Het
Zfp661 A G 2: 127,419,040 (GRCm39) C367R probably damaging Het
Znrf3 T A 11: 5,231,550 (GRCm39) E558D probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCCAGGGACAGAGAGTG -3'
(R):5'- GGTCACAGGGGTCTGAATAG -3'

Sequencing Primer
(F):5'- GGTCACCCATCTCTTGGA -3'
(R):5'- GAATAGGCAGTTTGTTTCTGAATCC -3'
Posted On 2019-05-13