Incidental Mutation 'R7062:Myo3b'
ID548310
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7062 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70217157 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 308 (V308I)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: V336I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: V336I

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: V308I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: V308I

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,599,146 D1370V probably damaging Het
Ackr1 A T 1: 173,332,115 I279N possibly damaging Het
Adcy10 A G 1: 165,538,522 H536R probably benign Het
Adgrb3 T C 1: 25,826,085 T226A possibly damaging Het
Apol10b T A 15: 77,585,273 M235L probably benign Het
Arhgap44 T C 11: 65,011,932 T570A probably benign Het
Astn1 A G 1: 158,688,511 probably null Het
Camsap3 A G 8: 3,607,834 probably benign Het
Ccdc73 C T 2: 104,951,878 A193V probably damaging Het
Ccl20 G A 1: 83,117,814 C32Y probably damaging Het
Cdk11b A G 4: 155,626,811 E16G probably damaging Het
Celsr2 T A 3: 108,402,510 N1591I possibly damaging Het
Col5a2 T C 1: 45,417,625 E306G probably benign Het
Cpa1 C T 6: 30,640,677 A106V probably benign Het
Ctdspl G A 9: 119,037,470 R199H probably damaging Het
Cyfip2 G A 11: 46,260,832 P547S probably damaging Het
Cyp2c37 A T 19: 39,995,546 probably null Het
Dnajc16 A G 4: 141,766,690 F549L probably damaging Het
Dnm3 T A 1: 162,134,491 K50* probably null Het
Eci1 C T 17: 24,426,740 probably benign Het
Eif2b4 C T 5: 31,192,831 C49Y probably benign Het
Emc3 A T 6: 113,522,796 I56N probably damaging Het
Enthd1 A G 15: 80,452,544 L563P probably damaging Het
Ercc4 T A 16: 13,132,947 I635K probably damaging Het
Espl1 A C 15: 102,298,896 N265T probably benign Het
Fads2 T C 19: 10,065,598 probably null Het
Fam186a G A 15: 99,933,640 probably benign Het
Fastkd1 A T 2: 69,704,322 I368K possibly damaging Het
Fat1 G A 8: 44,950,216 M1I probably null Het
Foxj1 T C 11: 116,331,993 E328G probably benign Het
Gfod2 T C 8: 105,722,876 probably benign Het
Gm6525 C T 3: 84,174,891 R40C probably benign Het
Gna12 G A 5: 140,785,485 T144I probably benign Het
Ighv9-3 T C 12: 114,141,092 M11V probably benign Het
Kcnj14 T C 7: 45,817,890 Y344C probably damaging Het
Lrrc63 A T 14: 75,086,297 S496T probably benign Het
Ltn1 T C 16: 87,427,603 T78A probably damaging Het
Matr3 T A 18: 35,579,019 probably null Het
Mcpt4 A G 14: 56,060,668 M142T probably benign Het
Mroh7 A G 4: 106,683,980 F1154S probably damaging Het
Mrpl1 G T 5: 96,213,791 L12F probably benign Het
Nfasc A G 1: 132,601,969 probably null Het
Npc1l1 T A 11: 6,217,807 M995L probably benign Het
Nvl A G 1: 181,112,334 I617T probably benign Het
Oas1h C A 5: 120,861,465 probably benign Het
Oasl2 T A 5: 114,911,091 Y197* probably null Het
Olfr1156 T C 2: 87,950,224 E3G probably benign Het
Olfr262 T C 19: 12,240,725 N312S probably benign Het
Olfr495 C T 7: 108,395,830 R237* probably null Het
Olfr598 T C 7: 103,329,086 V200A probably benign Het
Olfr728 A G 14: 50,140,450 L63P probably damaging Het
Olfr955 A T 9: 39,470,057 I223N probably benign Het
Orc6 T C 8: 85,302,908 V27A probably damaging Het
Parp4 A T 14: 56,614,759 R799S possibly damaging Het
Pcdhga1 C A 18: 37,825,077 S826R probably damaging Het
Phldb1 T C 9: 44,696,135 R1258G probably damaging Het
Ppfia1 T C 7: 144,552,473 S21G probably benign Het
Ppp1r18 C A 17: 35,868,211 T326K probably damaging Het
Psg26 A G 7: 18,482,596 L106P probably damaging Het
Rabgap1l A T 1: 160,226,650 D265E probably benign Het
Rasgrp4 T C 7: 29,150,194 L554P possibly damaging Het
Rnf17 G T 14: 56,465,654 V621L probably benign Het
Sart3 T C 5: 113,745,602 K783R possibly damaging Het
Slc23a2 T A 2: 132,091,269 I90F probably damaging Het
Slc5a2 A T 7: 128,270,040 M331L probably damaging Het
Slc5a7 C G 17: 54,293,001 G128A probably damaging Het
Smcr8 A T 11: 60,780,354 Q776L probably damaging Het
Smpd4 T A 16: 17,640,971 D519E probably damaging Het
Smurf1 A T 5: 144,893,546 probably null Het
Spata18 T A 5: 73,659,293 N125K probably benign Het
Spice1 T A 16: 44,357,896 M94K probably damaging Het
Stard4 T C 18: 33,205,534 probably null Het
Stx17 A G 4: 48,140,442 D49G probably benign Het
Tbce T C 13: 14,019,795 D93G possibly damaging Het
Tbx21 T A 11: 97,098,893 D491V probably damaging Het
Tmbim4 G T 10: 120,208,826 probably benign Het
Tmem209 C T 6: 30,502,017 R62H probably damaging Het
Tmem237 A T 1: 59,119,612 probably null Het
Tmprss9 T C 10: 80,895,049 I803T probably benign Het
Trip4 C T 9: 65,885,010 A7T probably benign Het
Unc13a T C 8: 71,663,237 D107G probably benign Het
Uso1 C A 5: 92,192,740 Q672K possibly damaging Het
Washc2 T A 6: 116,219,988 N239K possibly damaging Het
Zfp661 A G 2: 127,577,120 C367R probably damaging Het
Znrf3 T A 11: 5,281,550 E558D probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTCCCAGGGACAGAGAGTG -3'
(R):5'- GGTCACAGGGGTCTGAATAG -3'

Sequencing Primer
(F):5'- GGTCACCCATCTCTTGGA -3'
(R):5'- GAATAGGCAGTTTGTTTCTGAATCC -3'
Posted On2019-05-13