Incidental Mutation 'R7062:Stx17'
ID 548317
Institutional Source Beutler Lab
Gene Symbol Stx17
Ensembl Gene ENSMUSG00000061455
Gene Name syntaxin 17
Synonyms 9030425C21Rik, 4833418L03Rik, 6330411F21Rik
MMRRC Submission 045158-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7062 (G1)
Quality Score 222.009
Status Validated
Chromosome 4
Chromosomal Location 48124915-48186507 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48140442 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 49 (D49G)
Ref Sequence ENSEMBL: ENSMUSP00000117512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064765] [ENSMUST00000107720] [ENSMUST00000107721] [ENSMUST00000153502]
AlphaFold Q9D0I4
Predicted Effect probably benign
Transcript: ENSMUST00000064765
AA Change: D49G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000068087
Gene: ENSMUSG00000061455
AA Change: D49G

DomainStartEndE-ValueType
low complexity region 74 88 N/A INTRINSIC
t_SNARE 156 223 9.65e-13 SMART
transmembrane domain 228 250 N/A INTRINSIC
transmembrane domain 255 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107720
AA Change: D49G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103348
Gene: ENSMUSG00000061455
AA Change: D49G

DomainStartEndE-ValueType
low complexity region 74 88 N/A INTRINSIC
t_SNARE 156 223 9.65e-13 SMART
transmembrane domain 228 250 N/A INTRINSIC
transmembrane domain 255 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107721
SMART Domains Protein: ENSMUSP00000103349
Gene: ENSMUSG00000061455

DomainStartEndE-ValueType
low complexity region 52 66 N/A INTRINSIC
t_SNARE 134 201 9.65e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153502
AA Change: D49G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117512
Gene: ENSMUSG00000061455
AA Change: D49G

DomainStartEndE-ValueType
coiled coil region 51 74 N/A INTRINSIC
Meta Mutation Damage Score 0.0767 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,544,872 (GRCm39) D1370V probably damaging Het
Ackr1 A T 1: 173,159,682 (GRCm39) I279N possibly damaging Het
Adcy10 A G 1: 165,366,091 (GRCm39) H536R probably benign Het
Adgrb3 T C 1: 25,865,166 (GRCm39) T226A possibly damaging Het
Apol10b T A 15: 77,469,473 (GRCm39) M235L probably benign Het
Arhgap44 T C 11: 64,902,758 (GRCm39) T570A probably benign Het
Astn1 A G 1: 158,516,081 (GRCm39) probably null Het
Camsap3 A G 8: 3,657,834 (GRCm39) probably benign Het
Ccdc73 C T 2: 104,782,223 (GRCm39) A193V probably damaging Het
Ccl20 G A 1: 83,095,535 (GRCm39) C32Y probably damaging Het
Cdk11b A G 4: 155,711,268 (GRCm39) E16G probably damaging Het
Celsr2 T A 3: 108,309,826 (GRCm39) N1591I possibly damaging Het
Col5a2 T C 1: 45,456,785 (GRCm39) E306G probably benign Het
Cpa1 C T 6: 30,640,676 (GRCm39) A106V probably benign Het
Ctdspl G A 9: 118,866,538 (GRCm39) R199H probably damaging Het
Cyfip2 G A 11: 46,151,659 (GRCm39) P547S probably damaging Het
Cyp2c37 A T 19: 39,983,990 (GRCm39) probably null Het
Dnajc16 A G 4: 141,494,001 (GRCm39) F549L probably damaging Het
Dnm3 T A 1: 161,962,060 (GRCm39) K50* probably null Het
Eci1 C T 17: 24,645,714 (GRCm39) probably benign Het
Eif2b4 C T 5: 31,350,175 (GRCm39) C49Y probably benign Het
Emc3 A T 6: 113,499,757 (GRCm39) I56N probably damaging Het
Enthd1 A G 15: 80,336,745 (GRCm39) L563P probably damaging Het
Ercc4 T A 16: 12,950,811 (GRCm39) I635K probably damaging Het
Espl1 A C 15: 102,207,331 (GRCm39) N265T probably benign Het
Fads2 T C 19: 10,042,962 (GRCm39) probably null Het
Fam186a G A 15: 99,831,521 (GRCm39) probably benign Het
Fastkd1 A T 2: 69,534,666 (GRCm39) I368K possibly damaging Het
Fat1 G A 8: 45,403,253 (GRCm39) M1I probably null Het
Foxj1 T C 11: 116,222,819 (GRCm39) E328G probably benign Het
Gfod2 T C 8: 106,449,508 (GRCm39) probably benign Het
Gm6525 C T 3: 84,082,198 (GRCm39) R40C probably benign Het
Gna12 G A 5: 140,771,240 (GRCm39) T144I probably benign Het
Ighv9-3 T C 12: 114,104,712 (GRCm39) M11V probably benign Het
Kcnj14 T C 7: 45,467,314 (GRCm39) Y344C probably damaging Het
Lrrc63 A T 14: 75,323,737 (GRCm39) S496T probably benign Het
Ltn1 T C 16: 87,224,491 (GRCm39) T78A probably damaging Het
Matr3 T A 18: 35,712,072 (GRCm39) probably null Het
Mcpt4 A G 14: 56,298,125 (GRCm39) M142T probably benign Het
Mroh7 A G 4: 106,541,177 (GRCm39) F1154S probably damaging Het
Mrpl1 G T 5: 96,361,650 (GRCm39) L12F probably benign Het
Myo3b G A 2: 70,047,501 (GRCm39) V308I probably benign Het
Nfasc A G 1: 132,529,707 (GRCm39) probably null Het
Npc1l1 T A 11: 6,167,807 (GRCm39) M995L probably benign Het
Nvl A G 1: 180,939,899 (GRCm39) I617T probably benign Het
Oas1h C A 5: 120,999,528 (GRCm39) probably benign Het
Oasl2 T A 5: 115,049,152 (GRCm39) Y197* probably null Het
Or4k1 A G 14: 50,377,907 (GRCm39) L63P probably damaging Het
Or52ab7 T C 7: 102,978,293 (GRCm39) V200A probably benign Het
Or5an1c T C 19: 12,218,089 (GRCm39) N312S probably benign Het
Or5l13 T C 2: 87,780,568 (GRCm39) E3G probably benign Het
Or5p70 C T 7: 107,995,037 (GRCm39) R237* probably null Het
Or8g35 A T 9: 39,381,353 (GRCm39) I223N probably benign Het
Orc6 T C 8: 86,029,537 (GRCm39) V27A probably damaging Het
Parp4 A T 14: 56,852,216 (GRCm39) R799S possibly damaging Het
Pcdhga1 C A 18: 37,958,130 (GRCm39) S826R probably damaging Het
Phldb1 T C 9: 44,607,432 (GRCm39) R1258G probably damaging Het
Ppfia1 T C 7: 144,106,210 (GRCm39) S21G probably benign Het
Ppp1r18 C A 17: 36,179,103 (GRCm39) T326K probably damaging Het
Psg26 A G 7: 18,216,521 (GRCm39) L106P probably damaging Het
Rabgap1l A T 1: 160,054,220 (GRCm39) D265E probably benign Het
Rasgrp4 T C 7: 28,849,619 (GRCm39) L554P possibly damaging Het
Rnf17 G T 14: 56,703,111 (GRCm39) V621L probably benign Het
Sart3 T C 5: 113,883,663 (GRCm39) K783R possibly damaging Het
Slc23a2 T A 2: 131,933,189 (GRCm39) I90F probably damaging Het
Slc5a2 A T 7: 127,869,212 (GRCm39) M331L probably damaging Het
Slc5a7 C G 17: 54,600,029 (GRCm39) G128A probably damaging Het
Smcr8 A T 11: 60,671,180 (GRCm39) Q776L probably damaging Het
Smpd4 T A 16: 17,458,835 (GRCm39) D519E probably damaging Het
Smurf1 A T 5: 144,830,356 (GRCm39) probably null Het
Spata18 T A 5: 73,816,636 (GRCm39) N125K probably benign Het
Spice1 T A 16: 44,178,259 (GRCm39) M94K probably damaging Het
Stard4 T C 18: 33,338,587 (GRCm39) probably null Het
Tbce T C 13: 14,194,380 (GRCm39) D93G possibly damaging Het
Tbx21 T A 11: 96,989,719 (GRCm39) D491V probably damaging Het
Tmbim4 G T 10: 120,044,731 (GRCm39) probably benign Het
Tmem209 C T 6: 30,502,016 (GRCm39) R62H probably damaging Het
Tmem237 A T 1: 59,158,771 (GRCm39) probably null Het
Tmprss9 T C 10: 80,730,883 (GRCm39) I803T probably benign Het
Trip4 C T 9: 65,792,292 (GRCm39) A7T probably benign Het
Unc13a T C 8: 72,115,881 (GRCm39) D107G probably benign Het
Uso1 C A 5: 92,340,599 (GRCm39) Q672K possibly damaging Het
Washc2 T A 6: 116,196,949 (GRCm39) N239K possibly damaging Het
Zfp661 A G 2: 127,419,040 (GRCm39) C367R probably damaging Het
Znrf3 T A 11: 5,231,550 (GRCm39) E558D probably damaging Het
Other mutations in Stx17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stx17 APN 4 48,158,955 (GRCm39) missense possibly damaging 0.72
IGL01625:Stx17 APN 4 48,181,526 (GRCm39) missense probably damaging 1.00
IGL01975:Stx17 APN 4 48,180,670 (GRCm39) missense probably damaging 1.00
R1977:Stx17 UTSW 4 48,181,553 (GRCm39) missense probably benign 0.00
R2069:Stx17 UTSW 4 48,158,870 (GRCm39) missense probably damaging 0.99
R4117:Stx17 UTSW 4 48,180,689 (GRCm39) missense probably damaging 1.00
R4201:Stx17 UTSW 4 48,158,870 (GRCm39) missense probably damaging 0.99
R4202:Stx17 UTSW 4 48,158,870 (GRCm39) missense probably damaging 0.99
R5265:Stx17 UTSW 4 48,183,470 (GRCm39) utr 3 prime probably benign
R5308:Stx17 UTSW 4 48,182,851 (GRCm39) utr 3 prime probably benign
R6414:Stx17 UTSW 4 48,158,809 (GRCm39) critical splice acceptor site probably null
R6499:Stx17 UTSW 4 48,183,478 (GRCm39) critical splice donor site probably null
R6969:Stx17 UTSW 4 48,140,462 (GRCm39) missense probably damaging 1.00
R7482:Stx17 UTSW 4 48,181,722 (GRCm39) missense possibly damaging 0.82
R8472:Stx17 UTSW 4 48,166,972 (GRCm39) missense probably benign 0.42
R8865:Stx17 UTSW 4 48,183,444 (GRCm39) missense unknown
R9130:Stx17 UTSW 4 48,159,071 (GRCm39) unclassified probably benign
R9563:Stx17 UTSW 4 48,180,739 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAACGCCTTCAGAAAGTTAAC -3'
(R):5'- ACTGAATTCCTGCCACTGCC -3'

Sequencing Primer
(F):5'- GCCTTCAGAAAGTTAACTGTCATTAC -3'
(R):5'- CCTCAGGCAGCTGCAAAAGG -3'
Posted On 2019-05-13