Incidental Mutation 'R7062:Dnajc16'
ID 548319
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 2900037O03Rik, 4732437J24Rik
MMRRC Submission 045158-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.724) question?
Stock # R7062 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 141487500-141518242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141494001 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 549 (F549L)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000038014
AA Change: F549L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: F549L

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,544,872 (GRCm39) D1370V probably damaging Het
Ackr1 A T 1: 173,159,682 (GRCm39) I279N possibly damaging Het
Adcy10 A G 1: 165,366,091 (GRCm39) H536R probably benign Het
Adgrb3 T C 1: 25,865,166 (GRCm39) T226A possibly damaging Het
Apol10b T A 15: 77,469,473 (GRCm39) M235L probably benign Het
Arhgap44 T C 11: 64,902,758 (GRCm39) T570A probably benign Het
Astn1 A G 1: 158,516,081 (GRCm39) probably null Het
Camsap3 A G 8: 3,657,834 (GRCm39) probably benign Het
Ccdc73 C T 2: 104,782,223 (GRCm39) A193V probably damaging Het
Ccl20 G A 1: 83,095,535 (GRCm39) C32Y probably damaging Het
Cdk11b A G 4: 155,711,268 (GRCm39) E16G probably damaging Het
Celsr2 T A 3: 108,309,826 (GRCm39) N1591I possibly damaging Het
Col5a2 T C 1: 45,456,785 (GRCm39) E306G probably benign Het
Cpa1 C T 6: 30,640,676 (GRCm39) A106V probably benign Het
Ctdspl G A 9: 118,866,538 (GRCm39) R199H probably damaging Het
Cyfip2 G A 11: 46,151,659 (GRCm39) P547S probably damaging Het
Cyp2c37 A T 19: 39,983,990 (GRCm39) probably null Het
Dnm3 T A 1: 161,962,060 (GRCm39) K50* probably null Het
Eci1 C T 17: 24,645,714 (GRCm39) probably benign Het
Eif2b4 C T 5: 31,350,175 (GRCm39) C49Y probably benign Het
Emc3 A T 6: 113,499,757 (GRCm39) I56N probably damaging Het
Enthd1 A G 15: 80,336,745 (GRCm39) L563P probably damaging Het
Ercc4 T A 16: 12,950,811 (GRCm39) I635K probably damaging Het
Espl1 A C 15: 102,207,331 (GRCm39) N265T probably benign Het
Fads2 T C 19: 10,042,962 (GRCm39) probably null Het
Fam186a G A 15: 99,831,521 (GRCm39) probably benign Het
Fastkd1 A T 2: 69,534,666 (GRCm39) I368K possibly damaging Het
Fat1 G A 8: 45,403,253 (GRCm39) M1I probably null Het
Foxj1 T C 11: 116,222,819 (GRCm39) E328G probably benign Het
Gfod2 T C 8: 106,449,508 (GRCm39) probably benign Het
Gm6525 C T 3: 84,082,198 (GRCm39) R40C probably benign Het
Gna12 G A 5: 140,771,240 (GRCm39) T144I probably benign Het
Ighv9-3 T C 12: 114,104,712 (GRCm39) M11V probably benign Het
Kcnj14 T C 7: 45,467,314 (GRCm39) Y344C probably damaging Het
Lrrc63 A T 14: 75,323,737 (GRCm39) S496T probably benign Het
Ltn1 T C 16: 87,224,491 (GRCm39) T78A probably damaging Het
Matr3 T A 18: 35,712,072 (GRCm39) probably null Het
Mcpt4 A G 14: 56,298,125 (GRCm39) M142T probably benign Het
Mroh7 A G 4: 106,541,177 (GRCm39) F1154S probably damaging Het
Mrpl1 G T 5: 96,361,650 (GRCm39) L12F probably benign Het
Myo3b G A 2: 70,047,501 (GRCm39) V308I probably benign Het
Nfasc A G 1: 132,529,707 (GRCm39) probably null Het
Npc1l1 T A 11: 6,167,807 (GRCm39) M995L probably benign Het
Nvl A G 1: 180,939,899 (GRCm39) I617T probably benign Het
Oas1h C A 5: 120,999,528 (GRCm39) probably benign Het
Oasl2 T A 5: 115,049,152 (GRCm39) Y197* probably null Het
Or4k1 A G 14: 50,377,907 (GRCm39) L63P probably damaging Het
Or52ab7 T C 7: 102,978,293 (GRCm39) V200A probably benign Het
Or5an1c T C 19: 12,218,089 (GRCm39) N312S probably benign Het
Or5l13 T C 2: 87,780,568 (GRCm39) E3G probably benign Het
Or5p70 C T 7: 107,995,037 (GRCm39) R237* probably null Het
Or8g35 A T 9: 39,381,353 (GRCm39) I223N probably benign Het
Orc6 T C 8: 86,029,537 (GRCm39) V27A probably damaging Het
Parp4 A T 14: 56,852,216 (GRCm39) R799S possibly damaging Het
Pcdhga1 C A 18: 37,958,130 (GRCm39) S826R probably damaging Het
Phldb1 T C 9: 44,607,432 (GRCm39) R1258G probably damaging Het
Ppfia1 T C 7: 144,106,210 (GRCm39) S21G probably benign Het
Ppp1r18 C A 17: 36,179,103 (GRCm39) T326K probably damaging Het
Psg26 A G 7: 18,216,521 (GRCm39) L106P probably damaging Het
Rabgap1l A T 1: 160,054,220 (GRCm39) D265E probably benign Het
Rasgrp4 T C 7: 28,849,619 (GRCm39) L554P possibly damaging Het
Rnf17 G T 14: 56,703,111 (GRCm39) V621L probably benign Het
Sart3 T C 5: 113,883,663 (GRCm39) K783R possibly damaging Het
Slc23a2 T A 2: 131,933,189 (GRCm39) I90F probably damaging Het
Slc5a2 A T 7: 127,869,212 (GRCm39) M331L probably damaging Het
Slc5a7 C G 17: 54,600,029 (GRCm39) G128A probably damaging Het
Smcr8 A T 11: 60,671,180 (GRCm39) Q776L probably damaging Het
Smpd4 T A 16: 17,458,835 (GRCm39) D519E probably damaging Het
Smurf1 A T 5: 144,830,356 (GRCm39) probably null Het
Spata18 T A 5: 73,816,636 (GRCm39) N125K probably benign Het
Spice1 T A 16: 44,178,259 (GRCm39) M94K probably damaging Het
Stard4 T C 18: 33,338,587 (GRCm39) probably null Het
Stx17 A G 4: 48,140,442 (GRCm39) D49G probably benign Het
Tbce T C 13: 14,194,380 (GRCm39) D93G possibly damaging Het
Tbx21 T A 11: 96,989,719 (GRCm39) D491V probably damaging Het
Tmbim4 G T 10: 120,044,731 (GRCm39) probably benign Het
Tmem209 C T 6: 30,502,016 (GRCm39) R62H probably damaging Het
Tmem237 A T 1: 59,158,771 (GRCm39) probably null Het
Tmprss9 T C 10: 80,730,883 (GRCm39) I803T probably benign Het
Trip4 C T 9: 65,792,292 (GRCm39) A7T probably benign Het
Unc13a T C 8: 72,115,881 (GRCm39) D107G probably benign Het
Uso1 C A 5: 92,340,599 (GRCm39) Q672K possibly damaging Het
Washc2 T A 6: 116,196,949 (GRCm39) N239K possibly damaging Het
Zfp661 A G 2: 127,419,040 (GRCm39) C367R probably damaging Het
Znrf3 T A 11: 5,231,550 (GRCm39) E558D probably damaging Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141,490,874 (GRCm39) splice site probably null
IGL00840:Dnajc16 APN 4 141,495,314 (GRCm39) missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141,491,008 (GRCm39) missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141,501,940 (GRCm39) missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141,504,244 (GRCm39) missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141,491,958 (GRCm39) missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141,495,043 (GRCm39) nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141,498,260 (GRCm39) missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141,491,996 (GRCm39) missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141,495,318 (GRCm39) missense probably benign
R0415:Dnajc16 UTSW 4 141,516,359 (GRCm39) nonsense probably null
R0532:Dnajc16 UTSW 4 141,516,320 (GRCm39) missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141,495,052 (GRCm39) nonsense probably null
R2959:Dnajc16 UTSW 4 141,493,856 (GRCm39) nonsense probably null
R3025:Dnajc16 UTSW 4 141,501,922 (GRCm39) missense probably benign
R3796:Dnajc16 UTSW 4 141,495,048 (GRCm39) missense probably benign
R3854:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R3856:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R4661:Dnajc16 UTSW 4 141,490,859 (GRCm39) missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141,495,280 (GRCm39) nonsense probably null
R5126:Dnajc16 UTSW 4 141,501,820 (GRCm39) missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141,491,994 (GRCm39) missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141,502,703 (GRCm39) missense probably benign
R6888:Dnajc16 UTSW 4 141,504,303 (GRCm39) missense probably benign 0.24
R7441:Dnajc16 UTSW 4 141,491,124 (GRCm39) missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141,501,879 (GRCm39) missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141,492,002 (GRCm39) missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141,494,018 (GRCm39) nonsense probably null
R9005:Dnajc16 UTSW 4 141,491,945 (GRCm39) missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141,510,371 (GRCm39) missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141,495,058 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTTGGTGAAGCTCGGCTCAG -3'
(R):5'- TCAGCTGAAAGCCAGATCCC -3'

Sequencing Primer
(F):5'- GTGAAGCTCGGCTCAGTCTTC -3'
(R):5'- AAGCCAGATCCCGAGGTTGTG -3'
Posted On 2019-05-13