Incidental Mutation 'R7062:Rasgrp4'
ID548335
Institutional Source Beutler Lab
Gene Symbol Rasgrp4
Ensembl Gene ENSMUSG00000030589
Gene NameRAS guanyl releasing protein 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7062 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29134851-29153961 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29150194 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 554 (L554P)
Ref Sequence ENSEMBL: ENSMUSP00000144753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032811] [ENSMUST00000094617] [ENSMUST00000123416] [ENSMUST00000134176] [ENSMUST00000159351] [ENSMUST00000159975] [ENSMUST00000160194] [ENSMUST00000160396] [ENSMUST00000161522] [ENSMUST00000164589] [ENSMUST00000203070] [ENSMUST00000203380] [ENSMUST00000204194] [ENSMUST00000204845] [ENSMUST00000205027]
Predicted Effect probably benign
Transcript: ENSMUST00000032811
AA Change: L623P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589
AA Change: L623P

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 590 4.12e-12 SMART
low complexity region 600 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094617
AA Change: L629P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589
AA Change: L629P

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 163 2e-29 BLAST
low complexity region 164 189 N/A INTRINSIC
RasGEF 198 434 2.92e-70 SMART
C1 542 596 1.81e-8 SMART
low complexity region 606 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123416
SMART Domains Protein: ENSMUSP00000122992
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 6 125 8.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134176
SMART Domains Protein: ENSMUSP00000120165
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 1 125 5.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144795
SMART Domains Protein: ENSMUSP00000121796
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 5 175 1.7e-30 PFAM
Pfam:DUF2465 172 213 1.3e-14 PFAM
Pfam:DUF2465 211 242 6.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153251
SMART Domains Protein: ENSMUSP00000117500
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 1 114 1.9e-22 PFAM
Pfam:DUF2465 111 196 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159351
SMART Domains Protein: ENSMUSP00000124183
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 7e-31 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
Blast:RasGEF 449 553 7e-25 BLAST
SCOP:d1ptq__ 541 573 1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159975
AA Change: L628P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589
AA Change: L628P

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 595 1.81e-8 SMART
low complexity region 605 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160194
SMART Domains Protein: ENSMUSP00000124908
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 8e-32 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 423 6.73e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160396
Predicted Effect probably benign
Transcript: ENSMUST00000161522
AA Change: L609P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589
AA Change: L609P

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 165 7e-32 BLAST
RasGEF 183 419 2.92e-70 SMART
C1 527 576 4.12e-12 SMART
low complexity region 586 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164589
SMART Domains Protein: ENSMUSP00000131477
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 8 327 3.8e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203070
AA Change: L531P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589
AA Change: L531P

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 504 1.8e-20 SMART
C1 449 498 2.1e-14 SMART
low complexity region 508 517 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203380
AA Change: L554P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589
AA Change: L554P

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 364 3e-25 SMART
C1 472 521 2.1e-14 SMART
low complexity region 531 540 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000204194
AA Change: L526P

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589
AA Change: L526P

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 85 336 1e-7 SMART
C1 444 493 2.1e-14 SMART
low complexity region 503 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204845
AA Change: L589P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589
AA Change: L589P

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 399 8.7e-49 SMART
C1 507 556 2.1e-14 SMART
low complexity region 566 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205027
AA Change: L434P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589
AA Change: L434P

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
C1 352 401 2.1e-14 SMART
low complexity region 411 420 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ras guanyl nucleotide-releasing protein (RasGRP) family of Ras guanine nucleotide exchange factors. It contains a Ras exchange motif, a diacylglycerol-binding domain, and two calcium-binding EF hands. This protein was shown to activate H-Ras in a cation-dependent manner in vitro. Expression of this protein in myeloid cell lines was found to be correlated with elevated level of activated RAS protein, and the RAS activation can be greatly enhanced by phorbol ester treatment, which suggested a role of this protein in diacylglycerol regulated cell signaling pathways. Studies of a mast cell leukemia cell line expressing substantial amounts of abnormal transcripts of this gene indicated that this gene may play an important role in the final stages of mast cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil reactive oxygen species production and chemotaxis in vitro. Mice homozygous for another knock-out allele exhibit decreased susceptibility to induced colitis and arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,599,146 D1370V probably damaging Het
Ackr1 A T 1: 173,332,115 I279N possibly damaging Het
Adcy10 A G 1: 165,538,522 H536R probably benign Het
Adgrb3 T C 1: 25,826,085 T226A possibly damaging Het
Apol10b T A 15: 77,585,273 M235L probably benign Het
Arhgap44 T C 11: 65,011,932 T570A probably benign Het
Astn1 A G 1: 158,688,511 probably null Het
Camsap3 A G 8: 3,607,834 probably benign Het
Ccdc73 C T 2: 104,951,878 A193V probably damaging Het
Ccl20 G A 1: 83,117,814 C32Y probably damaging Het
Cdk11b A G 4: 155,626,811 E16G probably damaging Het
Celsr2 T A 3: 108,402,510 N1591I possibly damaging Het
Col5a2 T C 1: 45,417,625 E306G probably benign Het
Cpa1 C T 6: 30,640,677 A106V probably benign Het
Ctdspl G A 9: 119,037,470 R199H probably damaging Het
Cyfip2 G A 11: 46,260,832 P547S probably damaging Het
Cyp2c37 A T 19: 39,995,546 probably null Het
Dnajc16 A G 4: 141,766,690 F549L probably damaging Het
Dnm3 T A 1: 162,134,491 K50* probably null Het
Eci1 C T 17: 24,426,740 probably benign Het
Eif2b4 C T 5: 31,192,831 C49Y probably benign Het
Emc3 A T 6: 113,522,796 I56N probably damaging Het
Enthd1 A G 15: 80,452,544 L563P probably damaging Het
Ercc4 T A 16: 13,132,947 I635K probably damaging Het
Espl1 A C 15: 102,298,896 N265T probably benign Het
Fads2 T C 19: 10,065,598 probably null Het
Fam186a G A 15: 99,933,640 probably benign Het
Fastkd1 A T 2: 69,704,322 I368K possibly damaging Het
Fat1 G A 8: 44,950,216 M1I probably null Het
Foxj1 T C 11: 116,331,993 E328G probably benign Het
Gfod2 T C 8: 105,722,876 probably benign Het
Gm6525 C T 3: 84,174,891 R40C probably benign Het
Gna12 G A 5: 140,785,485 T144I probably benign Het
Ighv9-3 T C 12: 114,141,092 M11V probably benign Het
Kcnj14 T C 7: 45,817,890 Y344C probably damaging Het
Lrrc63 A T 14: 75,086,297 S496T probably benign Het
Ltn1 T C 16: 87,427,603 T78A probably damaging Het
Matr3 T A 18: 35,579,019 probably null Het
Mcpt4 A G 14: 56,060,668 M142T probably benign Het
Mroh7 A G 4: 106,683,980 F1154S probably damaging Het
Mrpl1 G T 5: 96,213,791 L12F probably benign Het
Myo3b G A 2: 70,217,157 V308I probably benign Het
Nfasc A G 1: 132,601,969 probably null Het
Npc1l1 T A 11: 6,217,807 M995L probably benign Het
Nvl A G 1: 181,112,334 I617T probably benign Het
Oas1h C A 5: 120,861,465 probably benign Het
Oasl2 T A 5: 114,911,091 Y197* probably null Het
Olfr1156 T C 2: 87,950,224 E3G probably benign Het
Olfr262 T C 19: 12,240,725 N312S probably benign Het
Olfr495 C T 7: 108,395,830 R237* probably null Het
Olfr598 T C 7: 103,329,086 V200A probably benign Het
Olfr728 A G 14: 50,140,450 L63P probably damaging Het
Olfr955 A T 9: 39,470,057 I223N probably benign Het
Orc6 T C 8: 85,302,908 V27A probably damaging Het
Parp4 A T 14: 56,614,759 R799S possibly damaging Het
Pcdhga1 C A 18: 37,825,077 S826R probably damaging Het
Phldb1 T C 9: 44,696,135 R1258G probably damaging Het
Ppfia1 T C 7: 144,552,473 S21G probably benign Het
Ppp1r18 C A 17: 35,868,211 T326K probably damaging Het
Psg26 A G 7: 18,482,596 L106P probably damaging Het
Rabgap1l A T 1: 160,226,650 D265E probably benign Het
Rnf17 G T 14: 56,465,654 V621L probably benign Het
Sart3 T C 5: 113,745,602 K783R possibly damaging Het
Slc23a2 T A 2: 132,091,269 I90F probably damaging Het
Slc5a2 A T 7: 128,270,040 M331L probably damaging Het
Slc5a7 C G 17: 54,293,001 G128A probably damaging Het
Smcr8 A T 11: 60,780,354 Q776L probably damaging Het
Smpd4 T A 16: 17,640,971 D519E probably damaging Het
Smurf1 A T 5: 144,893,546 probably null Het
Spata18 T A 5: 73,659,293 N125K probably benign Het
Spice1 T A 16: 44,357,896 M94K probably damaging Het
Stard4 T C 18: 33,205,534 probably null Het
Stx17 A G 4: 48,140,442 D49G probably benign Het
Tbce T C 13: 14,019,795 D93G possibly damaging Het
Tbx21 T A 11: 97,098,893 D491V probably damaging Het
Tmbim4 G T 10: 120,208,826 probably benign Het
Tmem209 C T 6: 30,502,017 R62H probably damaging Het
Tmem237 A T 1: 59,119,612 probably null Het
Tmprss9 T C 10: 80,895,049 I803T probably benign Het
Trip4 C T 9: 65,885,010 A7T probably benign Het
Unc13a T C 8: 71,663,237 D107G probably benign Het
Uso1 C A 5: 92,192,740 Q672K possibly damaging Het
Washc2 T A 6: 116,219,988 N239K possibly damaging Het
Zfp661 A G 2: 127,577,120 C367R probably damaging Het
Znrf3 T A 11: 5,281,550 E558D probably damaging Het
Other mutations in Rasgrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Rasgrp4 APN 7 29148541 splice site probably benign
IGL01145:Rasgrp4 APN 7 29151473 missense possibly damaging 0.83
IGL01806:Rasgrp4 APN 7 29139050 missense possibly damaging 0.83
IGL02023:Rasgrp4 APN 7 29138910 missense probably damaging 1.00
IGL02499:Rasgrp4 APN 7 29151503 utr 3 prime probably benign
IGL02989:Rasgrp4 APN 7 29148406 missense probably damaging 1.00
IGL03281:Rasgrp4 APN 7 29146025 missense possibly damaging 0.69
R0092:Rasgrp4 UTSW 7 29145132 missense possibly damaging 0.74
R0390:Rasgrp4 UTSW 7 29145860 missense probably damaging 1.00
R0614:Rasgrp4 UTSW 7 29145851 missense probably damaging 1.00
R0628:Rasgrp4 UTSW 7 29140210 intron probably benign
R1420:Rasgrp4 UTSW 7 29140345 missense probably damaging 0.98
R1434:Rasgrp4 UTSW 7 29137727 critical splice donor site probably null
R1664:Rasgrp4 UTSW 7 29140263 missense probably benign 0.00
R1911:Rasgrp4 UTSW 7 29138877 missense probably damaging 1.00
R2164:Rasgrp4 UTSW 7 29139045 missense probably damaging 1.00
R4277:Rasgrp4 UTSW 7 29152594 unclassified probably benign
R5024:Rasgrp4 UTSW 7 29148407 missense probably damaging 1.00
R5423:Rasgrp4 UTSW 7 29145136 missense probably damaging 1.00
R5813:Rasgrp4 UTSW 7 29145214 missense probably damaging 1.00
R5823:Rasgrp4 UTSW 7 29137717 missense probably benign 0.00
R6268:Rasgrp4 UTSW 7 29143068 missense probably damaging 1.00
R6285:Rasgrp4 UTSW 7 29148383 missense probably damaging 1.00
R7269:Rasgrp4 UTSW 7 29148430 missense probably damaging 1.00
R7471:Rasgrp4 UTSW 7 29145980 missense probably damaging 1.00
R7535:Rasgrp4 UTSW 7 29139059 missense probably benign
R7792:Rasgrp4 UTSW 7 29143102 missense probably damaging 1.00
R7854:Rasgrp4 UTSW 7 29150610 missense unknown
R7855:Rasgrp4 UTSW 7 29150610 missense unknown
R8052:Rasgrp4 UTSW 7 29149937 missense probably damaging 1.00
R8144:Rasgrp4 UTSW 7 29149117 missense probably damaging 1.00
R8253:Rasgrp4 UTSW 7 29138862 missense possibly damaging 0.63
R8256:Rasgrp4 UTSW 7 29143075 missense probably damaging 1.00
R8671:Rasgrp4 UTSW 7 29143027 missense probably damaging 0.99
R8675:Rasgrp4 UTSW 7 29143027 missense probably damaging 0.99
R8872:Rasgrp4 UTSW 7 29139096 missense possibly damaging 0.86
Z1088:Rasgrp4 UTSW 7 29150536 intron probably benign
Z1186:Rasgrp4 UTSW 7 29137587 missense probably benign
Z1186:Rasgrp4 UTSW 7 29138816 missense probably benign 0.01
Z1186:Rasgrp4 UTSW 7 29145877 missense probably benign 0.01
Z1186:Rasgrp4 UTSW 7 29148560 missense probably benign 0.01
Z1186:Rasgrp4 UTSW 7 29148635 missense probably damaging 1.00
Z1186:Rasgrp4 UTSW 7 29150592 intron probably benign
Z1186:Rasgrp4 UTSW 7 29150596 intron probably benign
Predicted Primers PCR Primer
(F):5'- GACACTGCAGGGATCAAGTG -3'
(R):5'- GTGATTTCCACACCTGTCTGG -3'

Sequencing Primer
(F):5'- CTGCAGGGATCAAGTGAGAGTG -3'
(R):5'- TGGTTTGCCCAGACAAATGGC -3'
Posted On2019-05-13