Incidental Mutation 'R0612:Hdac5'
ID54834
Institutional Source Beutler Lab
Gene Symbol Hdac5
Ensembl Gene ENSMUSG00000008855
Gene Namehistone deacetylase 5
SynonymsmHDA1
MMRRC Submission 038801-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0612 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102194432-102230166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102196252 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1042 (V1042A)
Ref Sequence ENSEMBL: ENSMUSP00000102768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008999] [ENSMUST00000070334] [ENSMUST00000078975] [ENSMUST00000107150] [ENSMUST00000107151] [ENSMUST00000107152] [ENSMUST00000124077] [ENSMUST00000140962]
Predicted Effect possibly damaging
Transcript: ENSMUST00000008999
AA Change: V1061A

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000008999
Gene: ENSMUSG00000008855
AA Change: V1061A

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Pfam:HDAC4_Gln 86 174 1e-30 PFAM
low complexity region 233 247 N/A INTRINSIC
low complexity region 322 337 N/A INTRINSIC
low complexity region 502 541 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
coiled coil region 583 617 N/A INTRINSIC
Pfam:Hist_deacetyl 704 1034 1.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070334
SMART Domains Protein: ENSMUSP00000064276
Gene: ENSMUSG00000034793

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078975
SMART Domains Protein: ENSMUSP00000077995
Gene: ENSMUSG00000034793

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107150
AA Change: V1042A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102768
Gene: ENSMUSG00000008855
AA Change: V1042A

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
Pfam:HDAC4_Gln 66 155 5.1e-37 PFAM
low complexity region 214 228 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 483 522 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
coiled coil region 564 598 N/A INTRINSIC
Pfam:Hist_deacetyl 685 1015 9.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107151
AA Change: V958A

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102769
Gene: ENSMUSG00000008855
AA Change: V958A

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 1.1e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 618 931 1.2e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107152
AA Change: V1043A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102770
Gene: ENSMUSG00000008855
AA Change: V1043A

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 3.7e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 686 1016 6.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124077
SMART Domains Protein: ENSMUSP00000116672
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140481
Predicted Effect probably benign
Transcript: ENSMUST00000140962
AA Change: V34A

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115435
Gene: ENSMUSG00000008855
AA Change: V34A

DomainStartEndE-ValueType
PDB:2VQQ|B 1 71 3e-21 PDB
transmembrane domain 118 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155065
Meta Mutation Damage Score 0.6093 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.5%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the class II histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. It coimmunoprecipitates only with HDAC3 family member and might form multicomplex proteins. It also interacts with myocyte enhancer factor-2 (MEF2) proteins, resulting in repression of MEF2-dependent genes. This gene is thought to be associated with colon cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and display cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,611,973 probably null Het
Abca15 T C 7: 120,337,255 L181P probably damaging Het
Aldh3a1 A T 11: 61,214,619 I184F probably damaging Het
Arl6ip4 A G 5: 124,116,533 S30G probably benign Het
Atp9b T C 18: 80,753,956 E891G possibly damaging Het
Brsk1 T C 7: 4,707,426 L478P possibly damaging Het
Btaf1 G A 19: 36,969,137 V448I probably damaging Het
C330027C09Rik C T 16: 48,999,039 A112V probably benign Het
Cab39 T C 1: 85,818,515 probably null Het
Cacna2d4 G T 6: 119,281,718 probably benign Het
Capzb C T 4: 139,291,029 S253L probably benign Het
Ccdc174 A G 6: 91,890,892 probably benign Het
Ccdc180 C T 4: 45,927,969 A1168V probably damaging Het
Cdh19 T C 1: 110,893,170 probably benign Het
Cdh8 T C 8: 99,400,914 T22A probably benign Het
Cdk10 T C 8: 123,230,680 V181A probably benign Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cftr A C 6: 18,198,126 T20P probably benign Het
Clstn3 T C 6: 124,449,500 T576A probably damaging Het
Col1a2 G A 6: 4,516,003 V165I unknown Het
Copg2 A T 6: 30,861,469 probably null Het
Cps1 A G 1: 67,139,770 H47R probably benign Het
Cytip T C 2: 58,134,190 D206G possibly damaging Het
Dnmt1 C T 9: 20,918,193 E824K probably damaging Het
Dock7 A C 4: 98,989,233 V442G probably benign Het
Dsc1 T G 18: 20,114,516 K14T probably damaging Het
Dync1h1 C T 12: 110,616,496 P371L probably damaging Het
Enah A G 1: 181,906,448 probably benign Het
Fam189a1 C T 7: 64,761,801 V395M probably benign Het
Fastkd1 T C 2: 69,712,383 T27A probably benign Het
Fcho1 A G 8: 71,715,524 L248P probably damaging Het
Fezf1 A T 6: 23,247,029 V268D probably damaging Het
Fgd2 T A 17: 29,378,347 V547E probably benign Het
Flnb T A 14: 7,887,682 probably benign Het
Gabrg3 A G 7: 56,729,706 M316T probably damaging Het
Gigyf2 T C 1: 87,449,080 F1265L probably damaging Het
Git2 A G 5: 114,752,281 S271P probably damaging Het
Gm13103 G T 4: 143,852,088 probably benign Het
Gm14085 T C 2: 122,521,698 M339T probably damaging Het
Gorab T C 1: 163,397,169 D21G possibly damaging Het
Gpr179 T A 11: 97,338,438 T964S possibly damaging Het
Hoxa2 T A 6: 52,163,560 T149S probably damaging Het
Igsf8 G T 1: 172,319,407 *108L probably null Het
Il1rap C T 16: 26,701,105 T307M possibly damaging Het
Itih2 T C 2: 10,117,394 D232G probably benign Het
Jak3 A G 8: 71,683,377 Y607C probably damaging Het
Kcnh1 C T 1: 192,277,053 P305L probably damaging Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Lrrn2 T C 1: 132,937,728 L177P probably damaging Het
Map4k3 C A 17: 80,602,193 K712N probably damaging Het
Med11 A G 11: 70,452,084 T36A probably benign Het
Mmp14 A G 14: 54,440,434 D504G probably damaging Het
Mob1a A G 6: 83,334,158 T120A probably benign Het
Mr1 T A 1: 155,137,690 D47V probably damaging Het
Nacad G T 11: 6,601,382 A603E possibly damaging Het
Nwd1 T A 8: 72,667,680 W524R probably damaging Het
Olfr1508 T C 14: 52,463,551 T153A probably benign Het
Olfr525 T A 7: 140,323,188 M163K possibly damaging Het
Olfr742 A T 14: 50,515,482 T93S probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pde6c T A 19: 38,133,246 C101S probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdlim4 G A 11: 54,068,887 R16C probably damaging Het
Pet2 G A X: 89,405,366 R386* probably null Het
Pfkp A G 13: 6,605,634 probably null Het
Plcg2 T A 8: 117,573,365 S225T probably benign Het
Pramel1 T C 4: 143,397,531 S259P probably damaging Het
Rc3h2 T C 2: 37,411,215 N92D possibly damaging Het
Ric8b C A 10: 85,001,881 N517K probably damaging Het
Rnf34 G A 5: 122,864,174 R65H probably damaging Het
Rraga C T 4: 86,576,327 R137C probably damaging Het
Scube2 C T 7: 109,804,764 probably benign Het
Spata31d1d T C 13: 59,727,973 I583V probably benign Het
Suox T C 10: 128,670,656 E501G probably benign Het
Susd1 A G 4: 59,390,561 probably benign Het
Tac1 T C 6: 7,555,653 S14P probably damaging Het
Tbc1d8 T C 1: 39,372,515 E1080G possibly damaging Het
Tll1 A C 8: 64,071,310 S447R possibly damaging Het
Tmem132e G A 11: 82,443,372 V662M probably damaging Het
Upf2 G T 2: 6,034,098 probably benign Het
Uspl1 A G 5: 149,214,957 E989G probably damaging Het
Vmn1r58 T C 7: 5,410,619 H204R probably damaging Het
Vmn2r25 A T 6: 123,839,522 C367S probably damaging Het
Vps13b A T 15: 35,623,657 Q1240L probably benign Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Yeats2 T G 16: 20,186,425 V385G probably benign Het
Other mutations in Hdac5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hdac5 APN 11 102197342 missense probably damaging 1.00
IGL01614:Hdac5 APN 11 102200028 missense probably benign 0.38
IGL01799:Hdac5 APN 11 102200085 missense possibly damaging 0.71
IGL02839:Hdac5 APN 11 102204908 missense probably damaging 1.00
E0354:Hdac5 UTSW 11 102202146 unclassified probably benign
R0544:Hdac5 UTSW 11 102196096 missense probably damaging 1.00
R0632:Hdac5 UTSW 11 102205812 missense probably damaging 1.00
R0659:Hdac5 UTSW 11 102196024 missense probably damaging 1.00
R0930:Hdac5 UTSW 11 102204646 missense probably benign 0.02
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1475:Hdac5 UTSW 11 102202186 missense possibly damaging 0.94
R1491:Hdac5 UTSW 11 102201253 missense probably benign
R1596:Hdac5 UTSW 11 102204656 splice site probably null
R1673:Hdac5 UTSW 11 102198805 missense probably damaging 1.00
R1783:Hdac5 UTSW 11 102200516 missense probably benign
R1932:Hdac5 UTSW 11 102195872 splice site probably benign
R2197:Hdac5 UTSW 11 102204514 missense probably damaging 1.00
R2348:Hdac5 UTSW 11 102200014 missense probably benign 0.44
R2518:Hdac5 UTSW 11 102197136 missense probably damaging 1.00
R3081:Hdac5 UTSW 11 102205610 missense probably damaging 1.00
R3622:Hdac5 UTSW 11 102195818 missense probably benign 0.34
R4543:Hdac5 UTSW 11 102213944 intron probably benign
R4559:Hdac5 UTSW 11 102199102 unclassified probably benign
R4661:Hdac5 UTSW 11 102205849 missense probably damaging 1.00
R4682:Hdac5 UTSW 11 102206630 missense probably null 0.99
R4708:Hdac5 UTSW 11 102202193 missense probably damaging 0.97
R4933:Hdac5 UTSW 11 102200563 unclassified probably benign
R4957:Hdac5 UTSW 11 102205256 unclassified probably benign
R4991:Hdac5 UTSW 11 102205624 missense probably damaging 1.00
R5090:Hdac5 UTSW 11 102197713 missense probably damaging 1.00
R5103:Hdac5 UTSW 11 102196283 missense probably damaging 0.98
R5330:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5331:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5386:Hdac5 UTSW 11 102202141 missense possibly damaging 0.71
R5449:Hdac5 UTSW 11 102196097 nonsense probably null
R5682:Hdac5 UTSW 11 102213923 intron probably benign
R6615:Hdac5 UTSW 11 102197056 splice site probably null
R6705:Hdac5 UTSW 11 102201236 missense probably damaging 0.99
R6875:Hdac5 UTSW 11 102202276 missense probably damaging 1.00
R6952:Hdac5 UTSW 11 102204960 missense probably benign
R7179:Hdac5 UTSW 11 102204559 missense possibly damaging 0.74
R7368:Hdac5 UTSW 11 102197381 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGTACACAGCTCCAGTGTTTGCC -3'
(R):5'- ACTTGACCGCCATCTGTGATGC -3'

Sequencing Primer
(F):5'- CAGTGTTTGCCTATGGCAAGAAG -3'
(R):5'- GTCAGTAGGGACATCCACTTC -3'
Posted On2013-07-11