Incidental Mutation 'R7062:Orc6'
ID 548343
Institutional Source Beutler Lab
Gene Symbol Orc6
Ensembl Gene ENSMUSG00000031697
Gene Name origin recognition complex, subunit 6
Synonyms 6720420I10Rik, Orc6l
MMRRC Submission 045158-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7062 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 86026261-86034907 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86029537 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 27 (V27A)
Ref Sequence ENSEMBL: ENSMUSP00000126925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034131] [ENSMUST00000034132] [ENSMUST00000170141] [ENSMUST00000210146] [ENSMUST00000211396] [ENSMUST00000211597]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034131
SMART Domains Protein: ENSMUSP00000034131
Gene: ENSMUSG00000031696

DomainStartEndE-ValueType
Pfam:Vps35 15 753 6.8e-303 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034132
AA Change: V103A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034132
Gene: ENSMUSG00000031697
AA Change: V103A

DomainStartEndE-ValueType
Pfam:ORC6 6 108 1.5e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170141
AA Change: V27A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126925
Gene: ENSMUSG00000031697
AA Change: V27A

DomainStartEndE-ValueType
PDB:3M03|C 18 111 2e-51 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000210146
AA Change: V103A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211396
AA Change: V137A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000211597
AA Change: V103A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6396 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Gene silencing studies with small interfering RNA demonstrated that this protein plays an essential role in coordinating chromosome replication and segregation with cytokinesis. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,544,872 (GRCm39) D1370V probably damaging Het
Ackr1 A T 1: 173,159,682 (GRCm39) I279N possibly damaging Het
Adcy10 A G 1: 165,366,091 (GRCm39) H536R probably benign Het
Adgrb3 T C 1: 25,865,166 (GRCm39) T226A possibly damaging Het
Apol10b T A 15: 77,469,473 (GRCm39) M235L probably benign Het
Arhgap44 T C 11: 64,902,758 (GRCm39) T570A probably benign Het
Astn1 A G 1: 158,516,081 (GRCm39) probably null Het
Camsap3 A G 8: 3,657,834 (GRCm39) probably benign Het
Ccdc73 C T 2: 104,782,223 (GRCm39) A193V probably damaging Het
Ccl20 G A 1: 83,095,535 (GRCm39) C32Y probably damaging Het
Cdk11b A G 4: 155,711,268 (GRCm39) E16G probably damaging Het
Celsr2 T A 3: 108,309,826 (GRCm39) N1591I possibly damaging Het
Col5a2 T C 1: 45,456,785 (GRCm39) E306G probably benign Het
Cpa1 C T 6: 30,640,676 (GRCm39) A106V probably benign Het
Ctdspl G A 9: 118,866,538 (GRCm39) R199H probably damaging Het
Cyfip2 G A 11: 46,151,659 (GRCm39) P547S probably damaging Het
Cyp2c37 A T 19: 39,983,990 (GRCm39) probably null Het
Dnajc16 A G 4: 141,494,001 (GRCm39) F549L probably damaging Het
Dnm3 T A 1: 161,962,060 (GRCm39) K50* probably null Het
Eci1 C T 17: 24,645,714 (GRCm39) probably benign Het
Eif2b4 C T 5: 31,350,175 (GRCm39) C49Y probably benign Het
Emc3 A T 6: 113,499,757 (GRCm39) I56N probably damaging Het
Enthd1 A G 15: 80,336,745 (GRCm39) L563P probably damaging Het
Ercc4 T A 16: 12,950,811 (GRCm39) I635K probably damaging Het
Espl1 A C 15: 102,207,331 (GRCm39) N265T probably benign Het
Fads2 T C 19: 10,042,962 (GRCm39) probably null Het
Fam186a G A 15: 99,831,521 (GRCm39) probably benign Het
Fastkd1 A T 2: 69,534,666 (GRCm39) I368K possibly damaging Het
Fat1 G A 8: 45,403,253 (GRCm39) M1I probably null Het
Foxj1 T C 11: 116,222,819 (GRCm39) E328G probably benign Het
Gfod2 T C 8: 106,449,508 (GRCm39) probably benign Het
Gm6525 C T 3: 84,082,198 (GRCm39) R40C probably benign Het
Gna12 G A 5: 140,771,240 (GRCm39) T144I probably benign Het
Ighv9-3 T C 12: 114,104,712 (GRCm39) M11V probably benign Het
Kcnj14 T C 7: 45,467,314 (GRCm39) Y344C probably damaging Het
Lrrc63 A T 14: 75,323,737 (GRCm39) S496T probably benign Het
Ltn1 T C 16: 87,224,491 (GRCm39) T78A probably damaging Het
Matr3 T A 18: 35,712,072 (GRCm39) probably null Het
Mcpt4 A G 14: 56,298,125 (GRCm39) M142T probably benign Het
Mroh7 A G 4: 106,541,177 (GRCm39) F1154S probably damaging Het
Mrpl1 G T 5: 96,361,650 (GRCm39) L12F probably benign Het
Myo3b G A 2: 70,047,501 (GRCm39) V308I probably benign Het
Nfasc A G 1: 132,529,707 (GRCm39) probably null Het
Npc1l1 T A 11: 6,167,807 (GRCm39) M995L probably benign Het
Nvl A G 1: 180,939,899 (GRCm39) I617T probably benign Het
Oas1h C A 5: 120,999,528 (GRCm39) probably benign Het
Oasl2 T A 5: 115,049,152 (GRCm39) Y197* probably null Het
Or4k1 A G 14: 50,377,907 (GRCm39) L63P probably damaging Het
Or52ab7 T C 7: 102,978,293 (GRCm39) V200A probably benign Het
Or5an1c T C 19: 12,218,089 (GRCm39) N312S probably benign Het
Or5l13 T C 2: 87,780,568 (GRCm39) E3G probably benign Het
Or5p70 C T 7: 107,995,037 (GRCm39) R237* probably null Het
Or8g35 A T 9: 39,381,353 (GRCm39) I223N probably benign Het
Parp4 A T 14: 56,852,216 (GRCm39) R799S possibly damaging Het
Pcdhga1 C A 18: 37,958,130 (GRCm39) S826R probably damaging Het
Phldb1 T C 9: 44,607,432 (GRCm39) R1258G probably damaging Het
Ppfia1 T C 7: 144,106,210 (GRCm39) S21G probably benign Het
Ppp1r18 C A 17: 36,179,103 (GRCm39) T326K probably damaging Het
Psg26 A G 7: 18,216,521 (GRCm39) L106P probably damaging Het
Rabgap1l A T 1: 160,054,220 (GRCm39) D265E probably benign Het
Rasgrp4 T C 7: 28,849,619 (GRCm39) L554P possibly damaging Het
Rnf17 G T 14: 56,703,111 (GRCm39) V621L probably benign Het
Sart3 T C 5: 113,883,663 (GRCm39) K783R possibly damaging Het
Slc23a2 T A 2: 131,933,189 (GRCm39) I90F probably damaging Het
Slc5a2 A T 7: 127,869,212 (GRCm39) M331L probably damaging Het
Slc5a7 C G 17: 54,600,029 (GRCm39) G128A probably damaging Het
Smcr8 A T 11: 60,671,180 (GRCm39) Q776L probably damaging Het
Smpd4 T A 16: 17,458,835 (GRCm39) D519E probably damaging Het
Smurf1 A T 5: 144,830,356 (GRCm39) probably null Het
Spata18 T A 5: 73,816,636 (GRCm39) N125K probably benign Het
Spice1 T A 16: 44,178,259 (GRCm39) M94K probably damaging Het
Stard4 T C 18: 33,338,587 (GRCm39) probably null Het
Stx17 A G 4: 48,140,442 (GRCm39) D49G probably benign Het
Tbce T C 13: 14,194,380 (GRCm39) D93G possibly damaging Het
Tbx21 T A 11: 96,989,719 (GRCm39) D491V probably damaging Het
Tmbim4 G T 10: 120,044,731 (GRCm39) probably benign Het
Tmem209 C T 6: 30,502,016 (GRCm39) R62H probably damaging Het
Tmem237 A T 1: 59,158,771 (GRCm39) probably null Het
Tmprss9 T C 10: 80,730,883 (GRCm39) I803T probably benign Het
Trip4 C T 9: 65,792,292 (GRCm39) A7T probably benign Het
Unc13a T C 8: 72,115,881 (GRCm39) D107G probably benign Het
Uso1 C A 5: 92,340,599 (GRCm39) Q672K possibly damaging Het
Washc2 T A 6: 116,196,949 (GRCm39) N239K possibly damaging Het
Zfp661 A G 2: 127,419,040 (GRCm39) C367R probably damaging Het
Znrf3 T A 11: 5,231,550 (GRCm39) E558D probably damaging Het
Other mutations in Orc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Orc6 APN 8 86,034,272 (GRCm39) missense probably damaging 1.00
IGL02531:Orc6 APN 8 86,029,998 (GRCm39) missense probably damaging 1.00
IGL02713:Orc6 APN 8 86,034,215 (GRCm39) missense probably benign 0.00
IGL02997:Orc6 APN 8 86,032,837 (GRCm39) unclassified probably benign
R0685:Orc6 UTSW 8 86,027,783 (GRCm39) missense possibly damaging 0.93
R1667:Orc6 UTSW 8 86,031,914 (GRCm39) missense possibly damaging 0.94
R3619:Orc6 UTSW 8 86,026,623 (GRCm39) critical splice donor site probably null
R3810:Orc6 UTSW 8 86,026,613 (GRCm39) missense probably benign 0.05
R4707:Orc6 UTSW 8 86,029,579 (GRCm39) missense probably damaging 1.00
R4784:Orc6 UTSW 8 86,029,579 (GRCm39) missense probably damaging 1.00
R5743:Orc6 UTSW 8 86,029,585 (GRCm39) missense probably benign 0.02
R7199:Orc6 UTSW 8 86,029,590 (GRCm39) critical splice donor site probably null
R7803:Orc6 UTSW 8 86,030,037 (GRCm39) missense possibly damaging 0.77
R7880:Orc6 UTSW 8 86,031,873 (GRCm39) missense probably benign 0.01
R9512:Orc6 UTSW 8 86,029,522 (GRCm39) missense
R9521:Orc6 UTSW 8 86,026,615 (GRCm39) missense possibly damaging 0.95
R9620:Orc6 UTSW 8 86,026,430 (GRCm39) start gained probably benign
Y5406:Orc6 UTSW 8 86,034,302 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCACAGACTGGAGAGGTGGC -3'
(R):5'- CTGACTGTGCTTCTAACAACG -3'

Sequencing Primer
(F):5'- ACTGGAGAGGTGGCTCAGC -3'
(R):5'- TTTTAGAGAGCACCTGGGCTCAC -3'
Posted On 2019-05-13