Incidental Mutation 'R7062:Tmprss9'
ID 548349
Institutional Source Beutler Lab
Gene Symbol Tmprss9
Ensembl Gene ENSMUSG00000059406
Gene Name transmembrane protease, serine 9
Synonyms Serase-1B
MMRRC Submission 045158-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R7062 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 80707682-80735326 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80730883 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 803 (I803T)
Ref Sequence ENSEMBL: ENSMUSP00000152034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020440] [ENSMUST00000105333] [ENSMUST00000219817] [ENSMUST00000219896]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020440
SMART Domains Protein: ENSMUSP00000020440
Gene: ENSMUSG00000020219

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:zf-Tim10_DDP 23 87 4.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105333
AA Change: I803T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406
AA Change: I803T

DomainStartEndE-ValueType
Pfam:SEA 62 155 1.7e-10 PFAM
LDLa 189 227 1.15e-4 SMART
Tryp_SPc 238 467 2.43e-96 SMART
low complexity region 477 502 N/A INTRINSIC
Tryp_SPc 539 767 7.28e-86 SMART
Tryp_SPc 867 1093 1.62e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219817
AA Change: I803T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000219896
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound type II serine polyprotease that is cleaved to release three different proteases. Two of the proteases are active and can be inhibited by serine protease inhibitors, and one is thought to be catalytically inactive. This gene enhances the invasive capability of pancreatic cancer cells and may be involved in cancer progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,544,872 (GRCm39) D1370V probably damaging Het
Ackr1 A T 1: 173,159,682 (GRCm39) I279N possibly damaging Het
Adcy10 A G 1: 165,366,091 (GRCm39) H536R probably benign Het
Adgrb3 T C 1: 25,865,166 (GRCm39) T226A possibly damaging Het
Apol10b T A 15: 77,469,473 (GRCm39) M235L probably benign Het
Arhgap44 T C 11: 64,902,758 (GRCm39) T570A probably benign Het
Astn1 A G 1: 158,516,081 (GRCm39) probably null Het
Camsap3 A G 8: 3,657,834 (GRCm39) probably benign Het
Ccdc73 C T 2: 104,782,223 (GRCm39) A193V probably damaging Het
Ccl20 G A 1: 83,095,535 (GRCm39) C32Y probably damaging Het
Cdk11b A G 4: 155,711,268 (GRCm39) E16G probably damaging Het
Celsr2 T A 3: 108,309,826 (GRCm39) N1591I possibly damaging Het
Col5a2 T C 1: 45,456,785 (GRCm39) E306G probably benign Het
Cpa1 C T 6: 30,640,676 (GRCm39) A106V probably benign Het
Ctdspl G A 9: 118,866,538 (GRCm39) R199H probably damaging Het
Cyfip2 G A 11: 46,151,659 (GRCm39) P547S probably damaging Het
Cyp2c37 A T 19: 39,983,990 (GRCm39) probably null Het
Dnajc16 A G 4: 141,494,001 (GRCm39) F549L probably damaging Het
Dnm3 T A 1: 161,962,060 (GRCm39) K50* probably null Het
Eci1 C T 17: 24,645,714 (GRCm39) probably benign Het
Eif2b4 C T 5: 31,350,175 (GRCm39) C49Y probably benign Het
Emc3 A T 6: 113,499,757 (GRCm39) I56N probably damaging Het
Enthd1 A G 15: 80,336,745 (GRCm39) L563P probably damaging Het
Ercc4 T A 16: 12,950,811 (GRCm39) I635K probably damaging Het
Espl1 A C 15: 102,207,331 (GRCm39) N265T probably benign Het
Fads2 T C 19: 10,042,962 (GRCm39) probably null Het
Fam186a G A 15: 99,831,521 (GRCm39) probably benign Het
Fastkd1 A T 2: 69,534,666 (GRCm39) I368K possibly damaging Het
Fat1 G A 8: 45,403,253 (GRCm39) M1I probably null Het
Foxj1 T C 11: 116,222,819 (GRCm39) E328G probably benign Het
Gfod2 T C 8: 106,449,508 (GRCm39) probably benign Het
Gm6525 C T 3: 84,082,198 (GRCm39) R40C probably benign Het
Gna12 G A 5: 140,771,240 (GRCm39) T144I probably benign Het
Ighv9-3 T C 12: 114,104,712 (GRCm39) M11V probably benign Het
Kcnj14 T C 7: 45,467,314 (GRCm39) Y344C probably damaging Het
Lrrc63 A T 14: 75,323,737 (GRCm39) S496T probably benign Het
Ltn1 T C 16: 87,224,491 (GRCm39) T78A probably damaging Het
Matr3 T A 18: 35,712,072 (GRCm39) probably null Het
Mcpt4 A G 14: 56,298,125 (GRCm39) M142T probably benign Het
Mroh7 A G 4: 106,541,177 (GRCm39) F1154S probably damaging Het
Mrpl1 G T 5: 96,361,650 (GRCm39) L12F probably benign Het
Myo3b G A 2: 70,047,501 (GRCm39) V308I probably benign Het
Nfasc A G 1: 132,529,707 (GRCm39) probably null Het
Npc1l1 T A 11: 6,167,807 (GRCm39) M995L probably benign Het
Nvl A G 1: 180,939,899 (GRCm39) I617T probably benign Het
Oas1h C A 5: 120,999,528 (GRCm39) probably benign Het
Oasl2 T A 5: 115,049,152 (GRCm39) Y197* probably null Het
Or4k1 A G 14: 50,377,907 (GRCm39) L63P probably damaging Het
Or52ab7 T C 7: 102,978,293 (GRCm39) V200A probably benign Het
Or5an1c T C 19: 12,218,089 (GRCm39) N312S probably benign Het
Or5l13 T C 2: 87,780,568 (GRCm39) E3G probably benign Het
Or5p70 C T 7: 107,995,037 (GRCm39) R237* probably null Het
Or8g35 A T 9: 39,381,353 (GRCm39) I223N probably benign Het
Orc6 T C 8: 86,029,537 (GRCm39) V27A probably damaging Het
Parp4 A T 14: 56,852,216 (GRCm39) R799S possibly damaging Het
Pcdhga1 C A 18: 37,958,130 (GRCm39) S826R probably damaging Het
Phldb1 T C 9: 44,607,432 (GRCm39) R1258G probably damaging Het
Ppfia1 T C 7: 144,106,210 (GRCm39) S21G probably benign Het
Ppp1r18 C A 17: 36,179,103 (GRCm39) T326K probably damaging Het
Psg26 A G 7: 18,216,521 (GRCm39) L106P probably damaging Het
Rabgap1l A T 1: 160,054,220 (GRCm39) D265E probably benign Het
Rasgrp4 T C 7: 28,849,619 (GRCm39) L554P possibly damaging Het
Rnf17 G T 14: 56,703,111 (GRCm39) V621L probably benign Het
Sart3 T C 5: 113,883,663 (GRCm39) K783R possibly damaging Het
Slc23a2 T A 2: 131,933,189 (GRCm39) I90F probably damaging Het
Slc5a2 A T 7: 127,869,212 (GRCm39) M331L probably damaging Het
Slc5a7 C G 17: 54,600,029 (GRCm39) G128A probably damaging Het
Smcr8 A T 11: 60,671,180 (GRCm39) Q776L probably damaging Het
Smpd4 T A 16: 17,458,835 (GRCm39) D519E probably damaging Het
Smurf1 A T 5: 144,830,356 (GRCm39) probably null Het
Spata18 T A 5: 73,816,636 (GRCm39) N125K probably benign Het
Spice1 T A 16: 44,178,259 (GRCm39) M94K probably damaging Het
Stard4 T C 18: 33,338,587 (GRCm39) probably null Het
Stx17 A G 4: 48,140,442 (GRCm39) D49G probably benign Het
Tbce T C 13: 14,194,380 (GRCm39) D93G possibly damaging Het
Tbx21 T A 11: 96,989,719 (GRCm39) D491V probably damaging Het
Tmbim4 G T 10: 120,044,731 (GRCm39) probably benign Het
Tmem209 C T 6: 30,502,016 (GRCm39) R62H probably damaging Het
Tmem237 A T 1: 59,158,771 (GRCm39) probably null Het
Trip4 C T 9: 65,792,292 (GRCm39) A7T probably benign Het
Unc13a T C 8: 72,115,881 (GRCm39) D107G probably benign Het
Uso1 C A 5: 92,340,599 (GRCm39) Q672K possibly damaging Het
Washc2 T A 6: 116,196,949 (GRCm39) N239K possibly damaging Het
Zfp661 A G 2: 127,419,040 (GRCm39) C367R probably damaging Het
Znrf3 T A 11: 5,231,550 (GRCm39) E558D probably damaging Het
Other mutations in Tmprss9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tmprss9 APN 10 80,730,262 (GRCm39) critical splice donor site probably null
IGL00990:Tmprss9 APN 10 80,728,126 (GRCm39) missense possibly damaging 0.92
IGL01710:Tmprss9 APN 10 80,733,793 (GRCm39) unclassified probably benign
IGL03075:Tmprss9 APN 10 80,719,863 (GRCm39) missense possibly damaging 0.77
IGL03132:Tmprss9 APN 10 80,730,699 (GRCm39) missense probably damaging 0.98
R0142:Tmprss9 UTSW 10 80,730,212 (GRCm39) missense possibly damaging 0.92
R0546:Tmprss9 UTSW 10 80,735,157 (GRCm39) missense probably benign 0.00
R1171:Tmprss9 UTSW 10 80,715,692 (GRCm39) missense possibly damaging 0.92
R1296:Tmprss9 UTSW 10 80,726,279 (GRCm39) missense probably benign 0.02
R1302:Tmprss9 UTSW 10 80,730,963 (GRCm39) missense probably benign 0.00
R1498:Tmprss9 UTSW 10 80,730,934 (GRCm39) missense probably benign 0.01
R1706:Tmprss9 UTSW 10 80,734,021 (GRCm39) unclassified probably benign
R1851:Tmprss9 UTSW 10 80,728,119 (GRCm39) missense probably damaging 0.98
R2096:Tmprss9 UTSW 10 80,725,268 (GRCm39) missense probably damaging 1.00
R2198:Tmprss9 UTSW 10 80,723,293 (GRCm39) missense probably damaging 1.00
R3783:Tmprss9 UTSW 10 80,723,301 (GRCm39) missense probably damaging 1.00
R5682:Tmprss9 UTSW 10 80,733,207 (GRCm39) splice site probably null
R5868:Tmprss9 UTSW 10 80,718,580 (GRCm39) missense probably benign 0.03
R6006:Tmprss9 UTSW 10 80,719,555 (GRCm39) missense possibly damaging 0.92
R6542:Tmprss9 UTSW 10 80,724,389 (GRCm39) missense probably damaging 1.00
R6676:Tmprss9 UTSW 10 80,734,145 (GRCm39) unclassified probably benign
R6718:Tmprss9 UTSW 10 80,726,198 (GRCm39) missense probably benign
R7316:Tmprss9 UTSW 10 80,730,813 (GRCm39) missense probably benign 0.00
R7337:Tmprss9 UTSW 10 80,718,504 (GRCm39) missense probably benign 0.00
R7624:Tmprss9 UTSW 10 80,728,053 (GRCm39) missense possibly damaging 0.77
R7659:Tmprss9 UTSW 10 80,728,843 (GRCm39) missense probably damaging 0.97
R7770:Tmprss9 UTSW 10 80,733,903 (GRCm39) splice site probably null
R7810:Tmprss9 UTSW 10 80,733,145 (GRCm39) missense unknown
R8177:Tmprss9 UTSW 10 80,730,882 (GRCm39) missense probably benign 0.00
R8324:Tmprss9 UTSW 10 80,733,205 (GRCm39) critical splice donor site probably null
R8354:Tmprss9 UTSW 10 80,723,320 (GRCm39) missense probably benign 0.04
R8454:Tmprss9 UTSW 10 80,723,320 (GRCm39) missense probably benign 0.04
R8456:Tmprss9 UTSW 10 80,730,251 (GRCm39) missense possibly damaging 0.92
R8729:Tmprss9 UTSW 10 80,726,177 (GRCm39) missense probably benign 0.01
R8968:Tmprss9 UTSW 10 80,730,163 (GRCm39) missense possibly damaging 0.71
R9010:Tmprss9 UTSW 10 80,733,701 (GRCm39) missense unknown
R9336:Tmprss9 UTSW 10 80,730,787 (GRCm39) missense probably benign 0.02
R9529:Tmprss9 UTSW 10 80,730,640 (GRCm39) missense probably damaging 0.99
R9786:Tmprss9 UTSW 10 80,734,042 (GRCm39) missense unknown
R9789:Tmprss9 UTSW 10 80,730,993 (GRCm39) missense probably benign 0.00
X0062:Tmprss9 UTSW 10 80,719,772 (GRCm39) splice site probably null
X0066:Tmprss9 UTSW 10 80,729,064 (GRCm39) missense probably damaging 0.99
Z1176:Tmprss9 UTSW 10 80,724,256 (GRCm39) missense probably damaging 0.98
Z1177:Tmprss9 UTSW 10 80,723,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATGTGAAGAGACACC -3'
(R):5'- AGCCCGAGTTACCATACCTG -3'

Sequencing Primer
(F):5'- TACCTGGCTGGCATCGTGAG -3'
(R):5'- CCTGGCAGGTGAGAGTGTATG -3'
Posted On 2019-05-13