Incidental Mutation 'R7062:Smpd4'
ID548370
Institutional Source Beutler Lab
Gene Symbol Smpd4
Ensembl Gene ENSMUSG00000005899
Gene Namesphingomyelin phosphodiesterase 4
Synonyms4122402O22Rik, neutral membrane (neutral sphingomyelinase-3)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7062 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location17619354-17644828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17640971 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 519 (D519E)
Ref Sequence ENSEMBL: ENSMUSP00000006053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006053] [ENSMUST00000090159] [ENSMUST00000163476] [ENSMUST00000165363] [ENSMUST00000231436] [ENSMUST00000231627] [ENSMUST00000231722] [ENSMUST00000231792] [ENSMUST00000232021] [ENSMUST00000232116] [ENSMUST00000232271]
Predicted Effect probably damaging
Transcript: ENSMUST00000006053
AA Change: D519E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006053
Gene: ENSMUSG00000005899
AA Change: D519E

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 768 N/A PFAM
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090159
AA Change: D503E

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000087620
Gene: ENSMUSG00000005899
AA Change: D503E

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.4e-177 PFAM
Pfam:mit_SMPDase 287 752 9.4e-259 PFAM
transmembrane domain 753 775 N/A INTRINSIC
transmembrane domain 782 799 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163476
AA Change: D490E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131867
Gene: ENSMUSG00000005899
AA Change: D490E

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 739 9.8e-266 PFAM
transmembrane domain 740 762 N/A INTRINSIC
transmembrane domain 769 786 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165363
AA Change: D489E

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130720
Gene: ENSMUSG00000005899
AA Change: D489E

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 738 4.1e-262 PFAM
transmembrane domain 739 761 N/A INTRINSIC
transmembrane domain 768 785 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231436
AA Change: D490E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000231627
Predicted Effect probably benign
Transcript: ENSMUST00000231722
Predicted Effect probably benign
Transcript: ENSMUST00000231792
AA Change: D269E

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232021
AA Change: D417E

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000232116
Predicted Effect possibly damaging
Transcript: ENSMUST00000232271
AA Change: D195E

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sphingomyelinases (EC 3.1.4.12), such as SMPD4, catalyze the hydrolysis of membrane sphingomyelin to form phosphorylcholine and ceramide (Krut et al., 2006 [PubMed 16517606]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,599,146 D1370V probably damaging Het
Ackr1 A T 1: 173,332,115 I279N possibly damaging Het
Adcy10 A G 1: 165,538,522 H536R probably benign Het
Adgrb3 T C 1: 25,826,085 T226A possibly damaging Het
Apol10b T A 15: 77,585,273 M235L probably benign Het
Arhgap44 T C 11: 65,011,932 T570A probably benign Het
Astn1 A G 1: 158,688,511 probably null Het
Camsap3 A G 8: 3,607,834 probably benign Het
Ccdc73 C T 2: 104,951,878 A193V probably damaging Het
Ccl20 G A 1: 83,117,814 C32Y probably damaging Het
Cdk11b A G 4: 155,626,811 E16G probably damaging Het
Celsr2 T A 3: 108,402,510 N1591I possibly damaging Het
Col5a2 T C 1: 45,417,625 E306G probably benign Het
Cpa1 C T 6: 30,640,677 A106V probably benign Het
Ctdspl G A 9: 119,037,470 R199H probably damaging Het
Cyfip2 G A 11: 46,260,832 P547S probably damaging Het
Cyp2c37 A T 19: 39,995,546 probably null Het
Dnajc16 A G 4: 141,766,690 F549L probably damaging Het
Dnm3 T A 1: 162,134,491 K50* probably null Het
Eci1 C T 17: 24,426,740 probably benign Het
Eif2b4 C T 5: 31,192,831 C49Y probably benign Het
Emc3 A T 6: 113,522,796 I56N probably damaging Het
Enthd1 A G 15: 80,452,544 L563P probably damaging Het
Ercc4 T A 16: 13,132,947 I635K probably damaging Het
Espl1 A C 15: 102,298,896 N265T probably benign Het
Fads2 T C 19: 10,065,598 probably null Het
Fam186a G A 15: 99,933,640 probably benign Het
Fastkd1 A T 2: 69,704,322 I368K possibly damaging Het
Fat1 G A 8: 44,950,216 M1I probably null Het
Foxj1 T C 11: 116,331,993 E328G probably benign Het
Gfod2 T C 8: 105,722,876 probably benign Het
Gm6525 C T 3: 84,174,891 R40C probably benign Het
Gna12 G A 5: 140,785,485 T144I probably benign Het
Ighv9-3 T C 12: 114,141,092 M11V probably benign Het
Kcnj14 T C 7: 45,817,890 Y344C probably damaging Het
Lrrc63 A T 14: 75,086,297 S496T probably benign Het
Ltn1 T C 16: 87,427,603 T78A probably damaging Het
Matr3 T A 18: 35,579,019 probably null Het
Mcpt4 A G 14: 56,060,668 M142T probably benign Het
Mroh7 A G 4: 106,683,980 F1154S probably damaging Het
Mrpl1 G T 5: 96,213,791 L12F probably benign Het
Myo3b G A 2: 70,217,157 V308I probably benign Het
Nfasc A G 1: 132,601,969 probably null Het
Npc1l1 T A 11: 6,217,807 M995L probably benign Het
Nvl A G 1: 181,112,334 I617T probably benign Het
Oas1h C A 5: 120,861,465 probably benign Het
Oasl2 T A 5: 114,911,091 Y197* probably null Het
Olfr1156 T C 2: 87,950,224 E3G probably benign Het
Olfr262 T C 19: 12,240,725 N312S probably benign Het
Olfr495 C T 7: 108,395,830 R237* probably null Het
Olfr598 T C 7: 103,329,086 V200A probably benign Het
Olfr728 A G 14: 50,140,450 L63P probably damaging Het
Olfr955 A T 9: 39,470,057 I223N probably benign Het
Orc6 T C 8: 85,302,908 V27A probably damaging Het
Parp4 A T 14: 56,614,759 R799S possibly damaging Het
Pcdhga1 C A 18: 37,825,077 S826R probably damaging Het
Phldb1 T C 9: 44,696,135 R1258G probably damaging Het
Ppfia1 T C 7: 144,552,473 S21G probably benign Het
Ppp1r18 C A 17: 35,868,211 T326K probably damaging Het
Psg26 A G 7: 18,482,596 L106P probably damaging Het
Rabgap1l A T 1: 160,226,650 D265E probably benign Het
Rasgrp4 T C 7: 29,150,194 L554P possibly damaging Het
Rnf17 G T 14: 56,465,654 V621L probably benign Het
Sart3 T C 5: 113,745,602 K783R possibly damaging Het
Slc23a2 T A 2: 132,091,269 I90F probably damaging Het
Slc5a2 A T 7: 128,270,040 M331L probably damaging Het
Slc5a7 C G 17: 54,293,001 G128A probably damaging Het
Smcr8 A T 11: 60,780,354 Q776L probably damaging Het
Smurf1 A T 5: 144,893,546 probably null Het
Spata18 T A 5: 73,659,293 N125K probably benign Het
Spice1 T A 16: 44,357,896 M94K probably damaging Het
Stard4 T C 18: 33,205,534 probably null Het
Stx17 A G 4: 48,140,442 D49G probably benign Het
Tbce T C 13: 14,019,795 D93G possibly damaging Het
Tbx21 T A 11: 97,098,893 D491V probably damaging Het
Tmbim4 G T 10: 120,208,826 probably benign Het
Tmem209 C T 6: 30,502,017 R62H probably damaging Het
Tmem237 A T 1: 59,119,612 probably null Het
Tmprss9 T C 10: 80,895,049 I803T probably benign Het
Trip4 C T 9: 65,885,010 A7T probably benign Het
Unc13a T C 8: 71,663,237 D107G probably benign Het
Uso1 C A 5: 92,192,740 Q672K possibly damaging Het
Washc2 T A 6: 116,219,988 N239K possibly damaging Het
Zfp661 A G 2: 127,577,120 C367R probably damaging Het
Znrf3 T A 11: 5,281,550 E558D probably damaging Het
Other mutations in Smpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Smpd4 APN 16 17642757 missense probably benign 0.04
IGL01461:Smpd4 APN 16 17621506 missense probably damaging 1.00
IGL02051:Smpd4 APN 16 17626518 missense probably damaging 1.00
IGL02492:Smpd4 APN 16 17639351 missense probably damaging 1.00
IGL03181:Smpd4 APN 16 17625807 nonsense probably null
Victim UTSW 16 17640971 missense probably damaging 1.00
weakling UTSW 16 17638486 intron probably benign
G1citation:Smpd4 UTSW 16 17640233 missense probably damaging 1.00
R0197:Smpd4 UTSW 16 17641597 critical splice donor site probably null
R0549:Smpd4 UTSW 16 17639312 missense probably benign 0.15
R0789:Smpd4 UTSW 16 17625826 missense probably benign 0.14
R1077:Smpd4 UTSW 16 17623969 missense probably damaging 1.00
R1120:Smpd4 UTSW 16 17638486 intron probably benign
R1716:Smpd4 UTSW 16 17642501 missense probably damaging 1.00
R1758:Smpd4 UTSW 16 17626008 missense probably damaging 0.99
R1758:Smpd4 UTSW 16 17640880 missense probably damaging 1.00
R1838:Smpd4 UTSW 16 17642302 splice site probably null
R2115:Smpd4 UTSW 16 17626865 missense probably benign 0.33
R2849:Smpd4 UTSW 16 17642212 missense probably damaging 1.00
R4654:Smpd4 UTSW 16 17642128 intron probably benign
R6157:Smpd4 UTSW 16 17641066 splice site probably null
R6190:Smpd4 UTSW 16 17632013 missense probably damaging 1.00
R6822:Smpd4 UTSW 16 17640233 missense probably damaging 1.00
R7305:Smpd4 UTSW 16 17641783 missense probably damaging 0.99
R7759:Smpd4 UTSW 16 17638633 missense probably damaging 1.00
R7853:Smpd4 UTSW 16 17642741 missense probably damaging 1.00
R8187:Smpd4 UTSW 16 17629135 missense probably damaging 1.00
R8303:Smpd4 UTSW 16 17639331 missense probably damaging 1.00
R8518:Smpd4 UTSW 16 17641020 missense possibly damaging 0.89
R8735:Smpd4 UTSW 16 17635546 missense possibly damaging 0.92
Z1176:Smpd4 UTSW 16 17619586 intron probably benign
Z1177:Smpd4 UTSW 16 17621441 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TTGCCACGGCTCTTCAGAAG -3'
(R):5'- AGCAGTTATACTTAGAGCACCC -3'

Sequencing Primer
(F):5'- CAGAAGCCAGAGCAAATTTTCTG -3'
(R):5'- TTATACTTAGAGCACCCACTCAATAC -3'
Posted On2019-05-13