Incidental Mutation 'R7062:Slc5a7'
ID548375
Institutional Source Beutler Lab
Gene Symbol Slc5a7
Ensembl Gene ENSMUSG00000023945
Gene Namesolute carrier family 5 (choline transporter), member 7
SynonymsCHT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7062 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location54273594-54299034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 54293001 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 128 (G128A)
Ref Sequence ENSEMBL: ENSMUSP00000093379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095712]
Predicted Effect probably damaging
Transcript: ENSMUST00000095712
AA Change: G128A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093379
Gene: ENSMUSG00000023945
AA Change: G128A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:SSF 42 442 4.7e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium ion- and chloride ion-dependent high-affinity transporter that mediates choline uptake for acetylcholine synthesis in cholinergic neurons. The protein transports choline from the extracellular space into presynaptic terminals for synthesis into acetylcholine. Increased choline uptake results from increased density of this protein in synaptosomal plasma membranes in response to depolarization of cholinergic terminals. Dysfunction of cholinergic signaling has been implicated in various disorders including depression, attention-deficit disorder, and schizophrenia. An allelic variant of this gene is associated with autosomal dominant distal hereditary motor neuronopathy type VIIA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display neonatal lethality with respiratory failure, hyporesponsiveness to touch, inability to sustain acetylcholine release, and abnormal neuromuscular junction morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,599,146 D1370V probably damaging Het
Ackr1 A T 1: 173,332,115 I279N possibly damaging Het
Adcy10 A G 1: 165,538,522 H536R probably benign Het
Adgrb3 T C 1: 25,826,085 T226A possibly damaging Het
Apol10b T A 15: 77,585,273 M235L probably benign Het
Arhgap44 T C 11: 65,011,932 T570A probably benign Het
Astn1 A G 1: 158,688,511 probably null Het
Camsap3 A G 8: 3,607,834 probably benign Het
Ccdc73 C T 2: 104,951,878 A193V probably damaging Het
Ccl20 G A 1: 83,117,814 C32Y probably damaging Het
Cdk11b A G 4: 155,626,811 E16G probably damaging Het
Celsr2 T A 3: 108,402,510 N1591I possibly damaging Het
Col5a2 T C 1: 45,417,625 E306G probably benign Het
Cpa1 C T 6: 30,640,677 A106V probably benign Het
Ctdspl G A 9: 119,037,470 R199H probably damaging Het
Cyfip2 G A 11: 46,260,832 P547S probably damaging Het
Cyp2c37 A T 19: 39,995,546 probably null Het
Dnajc16 A G 4: 141,766,690 F549L probably damaging Het
Dnm3 T A 1: 162,134,491 K50* probably null Het
Eci1 C T 17: 24,426,740 probably benign Het
Eif2b4 C T 5: 31,192,831 C49Y probably benign Het
Emc3 A T 6: 113,522,796 I56N probably damaging Het
Enthd1 A G 15: 80,452,544 L563P probably damaging Het
Ercc4 T A 16: 13,132,947 I635K probably damaging Het
Espl1 A C 15: 102,298,896 N265T probably benign Het
Fads2 T C 19: 10,065,598 probably null Het
Fam186a G A 15: 99,933,640 probably benign Het
Fastkd1 A T 2: 69,704,322 I368K possibly damaging Het
Fat1 G A 8: 44,950,216 M1I probably null Het
Foxj1 T C 11: 116,331,993 E328G probably benign Het
Gfod2 T C 8: 105,722,876 probably benign Het
Gm6525 C T 3: 84,174,891 R40C probably benign Het
Gna12 G A 5: 140,785,485 T144I probably benign Het
Ighv9-3 T C 12: 114,141,092 M11V probably benign Het
Kcnj14 T C 7: 45,817,890 Y344C probably damaging Het
Lrrc63 A T 14: 75,086,297 S496T probably benign Het
Ltn1 T C 16: 87,427,603 T78A probably damaging Het
Matr3 T A 18: 35,579,019 probably null Het
Mcpt4 A G 14: 56,060,668 M142T probably benign Het
Mroh7 A G 4: 106,683,980 F1154S probably damaging Het
Mrpl1 G T 5: 96,213,791 L12F probably benign Het
Myo3b G A 2: 70,217,157 V308I probably benign Het
Nfasc A G 1: 132,601,969 probably null Het
Npc1l1 T A 11: 6,217,807 M995L probably benign Het
Nvl A G 1: 181,112,334 I617T probably benign Het
Oas1h C A 5: 120,861,465 probably benign Het
Oasl2 T A 5: 114,911,091 Y197* probably null Het
Olfr1156 T C 2: 87,950,224 E3G probably benign Het
Olfr262 T C 19: 12,240,725 N312S probably benign Het
Olfr495 C T 7: 108,395,830 R237* probably null Het
Olfr598 T C 7: 103,329,086 V200A probably benign Het
Olfr728 A G 14: 50,140,450 L63P probably damaging Het
Olfr955 A T 9: 39,470,057 I223N probably benign Het
Orc6 T C 8: 85,302,908 V27A probably damaging Het
Parp4 A T 14: 56,614,759 R799S possibly damaging Het
Pcdhga1 C A 18: 37,825,077 S826R probably damaging Het
Phldb1 T C 9: 44,696,135 R1258G probably damaging Het
Ppfia1 T C 7: 144,552,473 S21G probably benign Het
Ppp1r18 C A 17: 35,868,211 T326K probably damaging Het
Psg26 A G 7: 18,482,596 L106P probably damaging Het
Rabgap1l A T 1: 160,226,650 D265E probably benign Het
Rasgrp4 T C 7: 29,150,194 L554P possibly damaging Het
Rnf17 G T 14: 56,465,654 V621L probably benign Het
Sart3 T C 5: 113,745,602 K783R possibly damaging Het
Slc23a2 T A 2: 132,091,269 I90F probably damaging Het
Slc5a2 A T 7: 128,270,040 M331L probably damaging Het
Smcr8 A T 11: 60,780,354 Q776L probably damaging Het
Smpd4 T A 16: 17,640,971 D519E probably damaging Het
Smurf1 A T 5: 144,893,546 probably null Het
Spata18 T A 5: 73,659,293 N125K probably benign Het
Spice1 T A 16: 44,357,896 M94K probably damaging Het
Stard4 T C 18: 33,205,534 probably null Het
Stx17 A G 4: 48,140,442 D49G probably benign Het
Tbce T C 13: 14,019,795 D93G possibly damaging Het
Tbx21 T A 11: 97,098,893 D491V probably damaging Het
Tmbim4 G T 10: 120,208,826 probably benign Het
Tmem209 C T 6: 30,502,017 R62H probably damaging Het
Tmem237 A T 1: 59,119,612 probably null Het
Tmprss9 T C 10: 80,895,049 I803T probably benign Het
Trip4 C T 9: 65,885,010 A7T probably benign Het
Unc13a T C 8: 71,663,237 D107G probably benign Het
Uso1 C A 5: 92,192,740 Q672K possibly damaging Het
Washc2 T A 6: 116,219,988 N239K possibly damaging Het
Zfp661 A G 2: 127,577,120 C367R probably damaging Het
Znrf3 T A 11: 5,281,550 E558D probably damaging Het
Other mutations in Slc5a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Slc5a7 APN 17 54292960 missense probably benign 0.00
IGL01833:Slc5a7 APN 17 54281833 missense probably damaging 1.00
IGL02206:Slc5a7 APN 17 54296994 missense probably damaging 0.98
IGL02493:Slc5a7 APN 17 54293880 missense probably damaging 1.00
IGL02598:Slc5a7 APN 17 54284193 missense probably benign
IGL02693:Slc5a7 APN 17 54276919 missense probably benign 0.00
IGL02896:Slc5a7 APN 17 54293017 nonsense probably null
R0288:Slc5a7 UTSW 17 54293018 nonsense probably null
R1137:Slc5a7 UTSW 17 54293011 missense probably damaging 1.00
R1692:Slc5a7 UTSW 17 54281726 missense probably damaging 0.99
R1755:Slc5a7 UTSW 17 54292978 missense probably benign 0.01
R1987:Slc5a7 UTSW 17 54293835 missense probably damaging 1.00
R2373:Slc5a7 UTSW 17 54277126 missense probably damaging 1.00
R4170:Slc5a7 UTSW 17 54276858 missense probably benign 0.08
R4614:Slc5a7 UTSW 17 54276559 missense probably benign 0.00
R4785:Slc5a7 UTSW 17 54278700 missense probably damaging 1.00
R4793:Slc5a7 UTSW 17 54281794 missense possibly damaging 0.95
R4828:Slc5a7 UTSW 17 54276799 missense probably benign 0.11
R4847:Slc5a7 UTSW 17 54277140 missense possibly damaging 0.82
R4879:Slc5a7 UTSW 17 54276651 missense probably benign 0.04
R5152:Slc5a7 UTSW 17 54278833 missense possibly damaging 0.51
R5171:Slc5a7 UTSW 17 54276676 missense probably benign
R5196:Slc5a7 UTSW 17 54281722 critical splice donor site probably null
R5935:Slc5a7 UTSW 17 54276944 nonsense probably null
R6307:Slc5a7 UTSW 17 54276978 missense probably benign 0.12
R6354:Slc5a7 UTSW 17 54277033 missense probably damaging 1.00
R6357:Slc5a7 UTSW 17 54287361 missense probably benign 0.16
R6395:Slc5a7 UTSW 17 54278821 missense probably damaging 1.00
R6500:Slc5a7 UTSW 17 54284203 missense probably benign
R6643:Slc5a7 UTSW 17 54276616 missense probably benign 0.00
R7405:Slc5a7 UTSW 17 54297133 missense probably benign
R7470:Slc5a7 UTSW 17 54276962 nonsense probably null
R7477:Slc5a7 UTSW 17 54281759 missense probably damaging 1.00
R7942:Slc5a7 UTSW 17 54276681 missense possibly damaging 0.69
R8348:Slc5a7 UTSW 17 54276627 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGGCCACACTTCAATGATGTG -3'
(R):5'- AACAATTTGTTTTCCTGGAGAGGG -3'

Sequencing Primer
(F):5'- GCCACACTTCAATGATGTGATTCAGG -3'
(R):5'- TTTCCTGGAGAGGGGGAGATAG -3'
Posted On2019-05-13