Incidental Mutation 'R7063:Celf1'
ID548379
Institutional Source Beutler Lab
Gene Symbol Celf1
Ensembl Gene ENSMUSG00000005506
Gene NameCUGBP, Elav-like family member 1
SynonymsCUG-BP, D2Wsu101e, 1600010O03Rik, Brunol2, Cugbp1, CUG-BP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90940382-91019497 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 91012844 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005643] [ENSMUST00000068726] [ENSMUST00000068747] [ENSMUST00000111448] [ENSMUST00000111449] [ENSMUST00000111451] [ENSMUST00000111452] [ENSMUST00000111455] [ENSMUST00000177642]
Predicted Effect probably null
Transcript: ENSMUST00000005643
SMART Domains Protein: ENSMUSP00000005643
Gene: ENSMUSG00000005506

DomainStartEndE-ValueType
RRM 44 122 5.93e-17 SMART
RRM 136 211 2.52e-20 SMART
low complexity region 226 234 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
low complexity region 283 303 N/A INTRINSIC
low complexity region 311 338 N/A INTRINSIC
low complexity region 342 355 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
RRM 429 502 1.71e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000068726
SMART Domains Protein: ENSMUSP00000064323
Gene: ENSMUSG00000005506

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 283 315 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 332 357 N/A INTRINSIC
RRM 403 476 1.71e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000068747
SMART Domains Protein: ENSMUSP00000070438
Gene: ENSMUSG00000005506

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111448
SMART Domains Protein: ENSMUSP00000107075
Gene: ENSMUSG00000005506

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 252 272 N/A INTRINSIC
low complexity region 279 311 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 328 353 N/A INTRINSIC
RRM 399 472 1.71e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111449
SMART Domains Protein: ENSMUSP00000107076
Gene: ENSMUSG00000005506

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111451
SMART Domains Protein: ENSMUSP00000107078
Gene: ENSMUSG00000005506

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111452
SMART Domains Protein: ENSMUSP00000107079
Gene: ENSMUSG00000005506

DomainStartEndE-ValueType
RRM 44 122 5.93e-17 SMART
RRM 136 211 2.52e-20 SMART
low complexity region 226 234 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
low complexity region 283 303 N/A INTRINSIC
low complexity region 311 338 N/A INTRINSIC
low complexity region 342 355 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
RRM 429 502 1.71e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111455
SMART Domains Protein: ENSMUSP00000107082
Gene: ENSMUSG00000005506

DomainStartEndE-ValueType
RRM 44 122 5.93e-17 SMART
RRM 136 211 2.52e-20 SMART
low complexity region 226 234 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
low complexity region 283 303 N/A INTRINSIC
low complexity region 311 338 N/A INTRINSIC
low complexity region 342 355 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
RRM 429 502 1.71e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177642
SMART Domains Protein: ENSMUSP00000136109
Gene: ENSMUSG00000005506

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in significant postnatal lethality, growth retardation, and impaired fertility in both sexes. Male infertility is caused by a blockage of spermiogenesis at stage 7 and increased germ cell apoptosis but is not fully penetrant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Celf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Celf1 APN 2 91009207 missense possibly damaging 0.83
IGL02126:Celf1 APN 2 91001063 missense probably damaging 1.00
IGL02183:Celf1 APN 2 91001486 missense probably damaging 1.00
IGL02350:Celf1 APN 2 90998588 missense probably damaging 0.97
IGL02357:Celf1 APN 2 90998588 missense probably damaging 0.97
IGL02402:Celf1 APN 2 90998723 missense probably damaging 1.00
IGL02522:Celf1 APN 2 91009301 missense possibly damaging 0.46
R0033:Celf1 UTSW 2 91001453 splice site probably benign
R0033:Celf1 UTSW 2 91001453 splice site probably benign
R0147:Celf1 UTSW 2 91004690 splice site probably benign
R2008:Celf1 UTSW 2 91010408 missense probably damaging 0.97
R2132:Celf1 UTSW 2 91010446 missense probably damaging 1.00
R3769:Celf1 UTSW 2 90998648 missense probably damaging 1.00
R3845:Celf1 UTSW 2 91009238 missense possibly damaging 0.46
R3857:Celf1 UTSW 2 91012741 missense probably damaging 0.98
R3858:Celf1 UTSW 2 91012741 missense probably damaging 0.98
R5174:Celf1 UTSW 2 91001008 missense probably damaging 1.00
R5287:Celf1 UTSW 2 91009207 missense possibly damaging 0.83
R6395:Celf1 UTSW 2 91003858 missense probably benign 0.01
R6993:Celf1 UTSW 2 91010476 missense probably damaging 1.00
R7242:Celf1 UTSW 2 91003257 nonsense probably null
R7419:Celf1 UTSW 2 91003243 missense probably benign
R7502:Celf1 UTSW 2 91004755 nonsense probably null
X0062:Celf1 UTSW 2 90998594 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGGCCTTGGTGATGAGCATAC -3'
(R):5'- CAAAGCTACTGCCTGACATTTAC -3'

Sequencing Primer
(F):5'- GCCTTGGTGATGAGCATACTTAACAC -3'
(R):5'- AGTTCCTCTGGACCAATACTGTGAG -3'
Posted On2019-05-13