Incidental Mutation 'R7063:Pcmtd2'
ID548381
Institutional Source Beutler Lab
Gene Symbol Pcmtd2
Ensembl Gene ENSMUSG00000027589
Gene Nameprotein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181837854-181857461 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 181854983 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 130 (Y130*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029116] [ENSMUST00000108754]
Predicted Effect probably damaging
Transcript: ENSMUST00000029116
AA Change: I251N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029116
Gene: ENSMUSG00000027589
AA Change: I251N

DomainStartEndE-ValueType
Pfam:PCMT 9 224 1e-28 PFAM
low complexity region 277 284 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
low complexity region 341 356 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108754
AA Change: Y252*
SMART Domains Protein: ENSMUSP00000104385
Gene: ENSMUSG00000027589
AA Change: Y252*

DomainStartEndE-ValueType
Pfam:PCMT 9 215 2.1e-28 PFAM
Pfam:DOT1 58 158 1.5e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124346
AA Change: Y130*
SMART Domains Protein: ENSMUSP00000115743
Gene: ENSMUSG00000027589
AA Change: Y130*

DomainStartEndE-ValueType
Pfam:PCMT 8 103 4.5e-7 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Pcmtd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2377:Pcmtd2 UTSW 2 181855279 utr 3 prime probably benign
R3110:Pcmtd2 UTSW 2 181855129 missense probably damaging 0.98
R3111:Pcmtd2 UTSW 2 181855129 missense probably damaging 0.98
R3112:Pcmtd2 UTSW 2 181855129 missense probably damaging 0.98
R4571:Pcmtd2 UTSW 2 181842424 missense possibly damaging 0.65
R5108:Pcmtd2 UTSW 2 181844423 missense probably damaging 1.00
R5137:Pcmtd2 UTSW 2 181854994 missense possibly damaging 0.87
R5778:Pcmtd2 UTSW 2 181855198 missense probably benign 0.00
R5861:Pcmtd2 UTSW 2 181842475 missense probably damaging 0.96
R6841:Pcmtd2 UTSW 2 181844438 missense probably damaging 0.99
R7407:Pcmtd2 UTSW 2 181846605 missense possibly damaging 0.83
R7706:Pcmtd2 UTSW 2 181855075 missense probably damaging 1.00
R7747:Pcmtd2 UTSW 2 181851659 missense possibly damaging 0.91
R7769:Pcmtd2 UTSW 2 181851701 missense probably benign 0.00
R7896:Pcmtd2 UTSW 2 181854983 missense probably damaging 1.00
R7979:Pcmtd2 UTSW 2 181854983 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGTGTGGTGCAAAGTAGAC -3'
(R):5'- TGGTCTCCTGTAAGGTCCTC -3'

Sequencing Primer
(F):5'- GTGCAAAGTAGACCATTGGTTCC -3'
(R):5'- CTGCATCCTCACAGCTGG -3'
Posted On2019-05-13