Incidental Mutation 'R7063:Sypl2'
ID548383
Institutional Source Beutler Lab
Gene Symbol Sypl2
Ensembl Gene ENSMUSG00000027887
Gene Namesynaptophysin-like 2
SynonymsMg29
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108211472-108226648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108217655 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 130 (M130K)
Ref Sequence ENSEMBL: ENSMUSP00000116756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000141387]
Predicted Effect probably benign
Transcript: ENSMUST00000141387
AA Change: M130K

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116756
Gene: ENSMUSG00000027887
AA Change: M130K

DomainStartEndE-ValueType
low complexity region 9 65 N/A INTRINSIC
Pfam:MARVEL 107 309 7.2e-41 PFAM
low complexity region 318 326 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile, but exhibit reduced body weight, abnormal skeletal muscle membranes and irregular skeletal muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Sypl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Sypl2 APN 3 108226426 start gained probably benign
R0147:Sypl2 UTSW 3 108219095 missense possibly damaging 0.91
R0148:Sypl2 UTSW 3 108219095 missense possibly damaging 0.91
R0381:Sypl2 UTSW 3 108226157 missense possibly damaging 0.57
R0512:Sypl2 UTSW 3 108226170 missense possibly damaging 0.51
R0751:Sypl2 UTSW 3 108216756 missense probably damaging 0.98
R1279:Sypl2 UTSW 3 108217674 missense probably damaging 1.00
R3411:Sypl2 UTSW 3 108216729 missense possibly damaging 0.94
R4085:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R4086:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R4088:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R4089:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R4090:Sypl2 UTSW 3 108217676 missense possibly damaging 0.94
R7571:Sypl2 UTSW 3 108214538 makesense probably null
R7980:Sypl2 UTSW 3 108217692 missense probably damaging 1.00
R8364:Sypl2 UTSW 3 108217734 missense possibly damaging 0.62
R8558:Sypl2 UTSW 3 108217688 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCACACATAGGCATCAGG -3'
(R):5'- ACATGACTCCTTTCCCAGGGTG -3'

Sequencing Primer
(F):5'- TCAGGACTCAGGGAAACTATTAC -3'
(R):5'- CGGACAGGAGCCCCTATTG -3'
Posted On2019-05-13