Incidental Mutation 'R7063:C130060K24Rik'
ID548390
Institutional Source Beutler Lab
Gene Symbol C130060K24Rik
Ensembl Gene ENSMUSG00000029917
Gene NameRIKEN cDNA C130060K24 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location65381105-65458150 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 65441403 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133352] [ENSMUST00000170608]
Predicted Effect probably benign
Transcript: ENSMUST00000133352
SMART Domains Protein: ENSMUSP00000122416
Gene: ENSMUSG00000029917

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 55 113 1.2e-7 PFAM
Pfam:7tm_1 61 122 1.3e-14 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121875
Gene: ENSMUSG00000029917
AA Change: K33R

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170608
SMART Domains Protein: ENSMUSP00000130225
Gene: ENSMUSG00000029917

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 55 346 2.5e-5 PFAM
Pfam:7tm_1 61 331 7.2e-56 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in C130060K24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:C130060K24Rik APN 6 65381610 missense probably benign 0.36
IGL03335:C130060K24Rik APN 6 65453117 critical splice donor site probably null
R1291:C130060K24Rik UTSW 6 65452900 nonsense probably null
R1689:C130060K24Rik UTSW 6 65381607 missense possibly damaging 0.84
R1705:C130060K24Rik UTSW 6 65456306 missense probably benign 0.01
R2188:C130060K24Rik UTSW 6 65441276 missense probably damaging 0.97
R3955:C130060K24Rik UTSW 6 65453108 missense possibly damaging 0.73
R4058:C130060K24Rik UTSW 6 65381541 missense probably damaging 1.00
R4572:C130060K24Rik UTSW 6 65454991 missense probably benign 0.06
R4597:C130060K24Rik UTSW 6 65447424 critical splice donor site probably null
R4756:C130060K24Rik UTSW 6 65452914 missense probably benign 0.02
R5139:C130060K24Rik UTSW 6 65456219 missense probably damaging 0.98
R5872:C130060K24Rik UTSW 6 65441385 intron probably benign
R6193:C130060K24Rik UTSW 6 65456158 missense probably damaging 1.00
R6305:C130060K24Rik UTSW 6 65454991 missense probably benign 0.06
R6423:C130060K24Rik UTSW 6 65456093 missense probably benign 0.01
R6453:C130060K24Rik UTSW 6 65453030 missense possibly damaging 0.71
R6677:C130060K24Rik UTSW 6 65456245 missense probably benign
R6744:C130060K24Rik UTSW 6 65441340 missense possibly damaging 0.88
R6793:C130060K24Rik UTSW 6 65381421 missense probably benign 0.20
R6875:C130060K24Rik UTSW 6 65456336 missense probably benign 0.21
R6941:C130060K24Rik UTSW 6 65447401 missense probably damaging 1.00
R6995:C130060K24Rik UTSW 6 65441301 missense probably damaging 1.00
R7564:C130060K24Rik UTSW 6 65452907 nonsense probably null
R7699:C130060K24Rik UTSW 6 65452956 missense probably benign 0.30
R7700:C130060K24Rik UTSW 6 65452956 missense probably benign 0.30
R7711:C130060K24Rik UTSW 6 65441373 missense
R7799:C130060K24Rik UTSW 6 65456137 missense possibly damaging 0.78
R7801:C130060K24Rik UTSW 6 65441217 missense probably damaging 1.00
R8737:C130060K24Rik UTSW 6 65456276 missense probably benign
R8762:C130060K24Rik UTSW 6 65447409 missense probably benign 0.12
RF018:C130060K24Rik UTSW 6 65456190 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCATTGTGACAGAAATCCTTAC -3'
(R):5'- GCATAGAGCTGGTCTTACTGGG -3'

Sequencing Primer
(F):5'- CTATGACCTGCATTGCTGTGGAAAG -3'
(R):5'- TGAGGACTCTAACTTCAAAGGC -3'
Posted On2019-05-13