Incidental Mutation 'R7063:Arhgap35'
ID548391
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene NameRho GTPase activating protein 35
Synonymsp190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16493719-16614993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16565113 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000127379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
Predicted Effect probably benign
Transcript: ENSMUST00000075845
AA Change: V9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: V9A

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171937
AA Change: V9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: V9A

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16564415 missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16561700 missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16564474 missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16564267 missense probably benign
IGL01922:Arhgap35 APN 7 16564255 missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16563203 missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16563055 missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16563665 missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16562380 missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16562878 missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16497655 makesense probably null
PIT4382001:Arhgap35 UTSW 7 16563869 missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16561611 missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16561992 missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16563281 missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16561949 missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16563133 missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16498025 splice site probably null
R2292:Arhgap35 UTSW 7 16563551 missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16562576 missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16563722 missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16565075 missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16564738 missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16563586 missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16498626 missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16565134 missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16511187 splice site probably null
R5175:Arhgap35 UTSW 7 16562599 missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16562924 missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16563489 missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16563643 missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16562299 missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16562566 missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16561727 missense probably benign
R7276:Arhgap35 UTSW 7 16564568 missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16562207 missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16564861 missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16562648 missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16561528 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTCATTATTGACCACCCGCC -3'
(R):5'- CAGACATGTTGGCTATTTGGCG -3'

Sequencing Primer
(F):5'- GCCCACCAAAGTCACTGG -3'
(R):5'- GTTTGAAGAACTGACATCATACTGG -3'
Posted On2019-05-13