Incidental Mutation 'R7063:Arhgap35'
ID 548391
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene Name Rho GTPase activating protein 35
Synonyms p190A, 6430596G11Rik, p190RhoGAP, Grlf1, P190 RhoGAP
MMRRC Submission 045159-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7063 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16228398-16349313 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16299038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000127379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
AlphaFold Q91YM2
Predicted Effect probably benign
Transcript: ENSMUST00000075845
AA Change: V9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: V9A

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171937
AA Change: V9A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: V9A

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btbd6 A G 12: 112,941,132 (GRCm39) Y148C probably damaging Het
Casr T C 16: 36,314,936 (GRCm39) I968V probably benign Het
Celf1 T C 2: 90,843,189 (GRCm39) probably null Het
Chst2 G T 9: 95,287,621 (GRCm39) R242S probably benign Het
Clca3a1 T A 3: 144,460,967 (GRCm39) D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 (GRCm39) Y288C probably benign Het
Cyp2r1 A G 7: 114,152,184 (GRCm39) S49P probably damaging Het
Dnah5 A G 15: 28,233,394 (GRCm39) E251G probably benign Het
Eepd1 A G 9: 25,394,332 (GRCm39) R199G possibly damaging Het
Fat1 C T 8: 45,493,812 (GRCm39) T3986I probably benign Het
Gbp4 G A 5: 105,266,314 (GRCm39) R576C probably damaging Het
Glp1r A G 17: 31,144,532 (GRCm39) Y235C probably damaging Het
Gm6408 T C 5: 146,420,594 (GRCm39) I158T probably benign Het
Gpr89 C G 3: 96,783,014 (GRCm39) R312P probably damaging Het
Idh2 A G 7: 79,745,432 (GRCm39) V403A probably damaging Het
Lclat1 A G 17: 73,546,986 (GRCm39) E301G possibly damaging Het
Lgmn A G 12: 102,368,937 (GRCm39) Y181H probably damaging Het
Lgr5 T C 10: 115,292,639 (GRCm39) Y417C probably damaging Het
Man1a G T 10: 53,906,840 (GRCm39) N311K probably damaging Het
Nat10 G A 2: 103,578,422 (GRCm39) L228F probably benign Het
Or10d3 T G 9: 39,461,411 (GRCm39) Y252S possibly damaging Het
Or10v5 A G 19: 11,805,548 (GRCm39) F281L probably damaging Het
Or5b12b A G 19: 12,861,449 (GRCm39) D68G probably damaging Het
Or5p55 C A 7: 107,567,411 (GRCm39) A269E probably benign Het
Pcmtd2 T A 2: 181,496,776 (GRCm39) Y130* probably null Het
Potefam3f G A 8: 20,479,013 (GRCm39) C7Y Het
Qrfprl A G 6: 65,418,387 (GRCm39) probably benign Het
Rapgef5 A G 12: 117,652,864 (GRCm39) D62G possibly damaging Het
Serpina3m A T 12: 104,357,726 (GRCm39) I217L probably benign Het
Supt16 T C 14: 52,409,505 (GRCm39) R802G possibly damaging Het
Sypl2 A T 3: 108,124,971 (GRCm39) M130K probably benign Het
Tmtc2 A T 10: 105,184,386 (GRCm39) L503Q probably damaging Het
Ubald2 A G 11: 116,325,443 (GRCm39) Q60R probably benign Het
Vav1 C T 17: 57,618,860 (GRCm39) Q673* probably null Het
Vgll2 T C 10: 51,904,072 (GRCm39) S312P probably benign Het
Vmn1r191 C T 13: 22,362,864 (GRCm39) A297T probably benign Het
Vmn1r7 T A 6: 57,001,418 (GRCm39) I281F possibly damaging Het
Vmn2r108 T C 17: 20,701,410 (GRCm39) Y30C probably damaging Het
Vmn2r16 A G 5: 109,511,650 (GRCm39) N619S probably damaging Het
Vstm5 A G 9: 15,150,549 (GRCm39) probably benign Het
Zfp7 A G 15: 76,775,919 (GRCm39) I654V possibly damaging Het
Zmat2 A G 18: 36,929,627 (GRCm39) N129S probably null Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16,298,340 (GRCm39) missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16,295,625 (GRCm39) missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16,298,399 (GRCm39) missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16,298,192 (GRCm39) missense probably benign
IGL01922:Arhgap35 APN 7 16,298,180 (GRCm39) missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16,297,128 (GRCm39) missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16,296,980 (GRCm39) missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16,297,590 (GRCm39) missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16,296,305 (GRCm39) missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16,296,803 (GRCm39) missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16,231,580 (GRCm39) makesense probably null
PIT4382001:Arhgap35 UTSW 7 16,297,794 (GRCm39) missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16,295,536 (GRCm39) missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16,295,917 (GRCm39) missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16,297,206 (GRCm39) missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16,295,874 (GRCm39) missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16,297,058 (GRCm39) missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16,231,950 (GRCm39) splice site probably null
R2292:Arhgap35 UTSW 7 16,297,476 (GRCm39) missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16,296,501 (GRCm39) missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16,297,647 (GRCm39) missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16,299,000 (GRCm39) missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16,298,663 (GRCm39) missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16,297,511 (GRCm39) missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16,232,551 (GRCm39) missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16,299,059 (GRCm39) missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16,245,112 (GRCm39) splice site probably null
R5175:Arhgap35 UTSW 7 16,296,524 (GRCm39) missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16,296,849 (GRCm39) missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16,297,414 (GRCm39) missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16,297,392 (GRCm39) missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16,297,568 (GRCm39) missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16,297,392 (GRCm39) missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16,296,224 (GRCm39) missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16,299,038 (GRCm39) missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16,296,491 (GRCm39) missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16,295,652 (GRCm39) missense probably benign
R7276:Arhgap35 UTSW 7 16,298,493 (GRCm39) missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16,296,132 (GRCm39) missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16,298,786 (GRCm39) missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16,296,573 (GRCm39) missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16,295,453 (GRCm39) missense possibly damaging 0.88
R8101:Arhgap35 UTSW 7 16,296,244 (GRCm39) missense probably benign 0.00
R8873:Arhgap35 UTSW 7 16,295,415 (GRCm39) missense possibly damaging 0.92
R8956:Arhgap35 UTSW 7 16,348,404 (GRCm39) start gained probably benign
R9163:Arhgap35 UTSW 7 16,295,549 (GRCm39) missense possibly damaging 0.94
R9507:Arhgap35 UTSW 7 16,297,343 (GRCm39) missense probably benign 0.31
R9667:Arhgap35 UTSW 7 16,296,914 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCATTATTGACCACCCGCC -3'
(R):5'- CAGACATGTTGGCTATTTGGCG -3'

Sequencing Primer
(F):5'- GCCCACCAAAGTCACTGG -3'
(R):5'- GTTTGAAGAACTGACATCATACTGG -3'
Posted On 2019-05-13